ID: 988340248

View in Genome Browser
Species Human (GRCh38)
Location 5:29961053-29961075
Sequence ATCTAGGCCTTATCTGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988340248_988340252 29 Left 988340248 5:29961053-29961075 CCCAATGCAGATAAGGCCTAGAT No data
Right 988340252 5:29961105-29961127 GAAAGCCTTCTCAAGAAATTTGG No data
988340248_988340253 30 Left 988340248 5:29961053-29961075 CCCAATGCAGATAAGGCCTAGAT No data
Right 988340253 5:29961106-29961128 AAAGCCTTCTCAAGAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988340248 Original CRISPR ATCTAGGCCTTATCTGCATT GGG (reversed) Intergenic
No off target data available for this crispr