ID: 988342383

View in Genome Browser
Species Human (GRCh38)
Location 5:29989801-29989823
Sequence TATACGAGCATGTCTACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988342383_988342385 25 Left 988342383 5:29989801-29989823 CCAAATGTAGACATGCTCGTATA No data
Right 988342385 5:29989849-29989871 CACTTTAAAATATATTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988342383 Original CRISPR TATACGAGCATGTCTACATT TGG (reversed) Intergenic
No off target data available for this crispr