ID: 988343078

View in Genome Browser
Species Human (GRCh38)
Location 5:30000282-30000304
Sequence CAGGAAGTCATAGGTTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988343070_988343078 22 Left 988343070 5:30000237-30000259 CCTAGATTCTTATTTGTATCTTC No data
Right 988343078 5:30000282-30000304 CAGGAAGTCATAGGTTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988343078 Original CRISPR CAGGAAGTCATAGGTTTTGA TGG Intergenic