ID: 988356849

View in Genome Browser
Species Human (GRCh38)
Location 5:30187675-30187697
Sequence CATGGGAGGGACACAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988356840_988356849 -5 Left 988356840 5:30187657-30187679 CCCACAATTCCCACATGTCATGG 0: 124
1: 421
2: 1300
3: 3330
4: 5174
Right 988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG No data
988356842_988356849 -6 Left 988356842 5:30187658-30187680 CCACAATTCCCACATGTCATGGG 0: 120
1: 396
2: 1319
3: 3287
4: 5262
Right 988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG No data
988356839_988356849 24 Left 988356839 5:30187628-30187650 CCACACAAATCTCATCTTGAATT 0: 177
1: 8386
2: 11697
3: 9811
4: 8599
Right 988356849 5:30187675-30187697 CATGGGAGGGACACAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988356849 Original CRISPR CATGGGAGGGACACAGTGGA AGG Intergenic
No off target data available for this crispr