ID: 988358230

View in Genome Browser
Species Human (GRCh38)
Location 5:30203477-30203499
Sequence TAAGATTTAGATCCCCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 100, 1: 103, 2: 66, 3: 42, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988358230_988358233 12 Left 988358230 5:30203477-30203499 CCTAACAGGGGATCTAAATCTTA 0: 100
1: 103
2: 66
3: 42
4: 112
Right 988358233 5:30203512-30203534 ACAAAGGTCCGACCAGACCTAGG 0: 42
1: 113
2: 102
3: 58
4: 79
988358230_988358231 -4 Left 988358230 5:30203477-30203499 CCTAACAGGGGATCTAAATCTTA 0: 100
1: 103
2: 66
3: 42
4: 112
Right 988358231 5:30203496-30203518 CTTAACTAATCACCATACAAAGG No data
988358230_988358236 28 Left 988358230 5:30203477-30203499 CCTAACAGGGGATCTAAATCTTA 0: 100
1: 103
2: 66
3: 42
4: 112
Right 988358236 5:30203528-30203550 ACCTAGGAGAAACTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988358230 Original CRISPR TAAGATTTAGATCCCCTGTT AGG (reversed) Intergenic
902031927 1:13429214-13429236 TAAGATTTCGATCCCCTGTTAGG - Intergenic
902051805 1:13569065-13569087 TAAGATTTAAATCCCCTGTTAGG - Intergenic
903939985 1:26923014-26923036 TCAGATTTAGACCCACTCTTGGG + Intronic
904571295 1:31467793-31467815 TAAGATTTAGATCCCCTGTTAGG + Intergenic
904713130 1:32446690-32446712 TAAGATTTAGATACCCGGTTAGG + Intergenic
905567784 1:38979643-38979665 TAAGATTTAGATCCCCTGTTAGG + Intergenic
906507580 1:46391678-46391700 TAAGATTTAGATCCCATGTTAGG + Intergenic
906582481 1:46947565-46947587 TAAGATTTAAATCCCCCGTCAGG - Intergenic
906601132 1:47130304-47130326 TAAGATTTAAATCCCCTGTTAGG + Intergenic
906767026 1:48442936-48442958 TAAGATTTAGATTCCCTGCTAGG - Intronic
906914824 1:49997044-49997066 CAAGATTTAGAACTCCTTTTAGG - Intronic
907037228 1:51227244-51227266 TAAGATTTAAATCCCCTGTTAGG - Intergenic
907602686 1:55786667-55786689 GAAGATTTAAATCCTCTGTTAGG + Intergenic
908300886 1:62760121-62760143 TAAGATTTAGATCCCCTGTTAGG - Intergenic
910396975 1:86803310-86803332 TCAGATTTAGATCCCCTGTTAGG + Intergenic
910590736 1:88926256-88926278 TAAGATTTAAATCCCCTGTTAGG - Intergenic
910808251 1:91210298-91210320 TAAGATTTAGATCCCCTGTTAGG + Intergenic
911230775 1:95359424-95359446 TGAGATTAAGATTCCCTTTTGGG + Intergenic
911299187 1:96151989-96152011 TAAGATTTAGGTCCCCTGTAAGG - Intergenic
911751857 1:101504686-101504708 TAAGATTTAGATCTCCTGTTAGG - Intergenic
913470538 1:119181467-119181489 GAGGATTTAAATCCCCTGTTAGG + Intergenic
913713719 1:121512627-121512649 TAAGATTTAGATCCCCTGTTAGG - Intergenic
916084135 1:161256200-161256222 TAAGATTTAGTTGCCCTGTTAGG - Intergenic
917227794 1:172802476-172802498 TAAGATTTAGATCCCCTGTTAGG - Intergenic
917311938 1:173687920-173687942 TAAGATTTAGATCCCCTGCTAGG + Intergenic
917676585 1:177324403-177324425 TAAGATTTAGATCCCCTGTTAGG - Intergenic
919002483 1:191850954-191850976 TTAGATTTAGATCACATTTTGGG + Intergenic
919172985 1:193979776-193979798 TAACATTTAGAACTCCTCTTTGG + Intergenic
919257251 1:195140539-195140561 TAAGATTTAGATCCCCTGTTAGG - Intergenic
919559170 1:199096308-199096330 TAAAATTTAGATCCCCTGTTAGG - Intergenic
920425377 1:205870889-205870911 TAAGATTTAAATCCCCCGTTAGG + Intergenic
921020176 1:211227974-211227996 TAAGATTTAGATCCCCTGTTAGG - Intergenic
921583574 1:216923599-216923621 TAAGATCTTGATCCTCTGCTCGG - Intronic
923174257 1:231447973-231447995 TAAGATTTAGAACTCCAGCTGGG - Intergenic
924877028 1:248116837-248116859 TTAGATTTGGATTCCCTGTTAGG + Intergenic
1063415164 10:5867221-5867243 TAAGAGTTAGATCCCCTGTTAGG - Intronic
1064603089 10:17012931-17012953 TAAGATTTAGATCCCCTGTTAGG + Intronic
1064756292 10:18574411-18574433 TTAGATTTGGATTTCCTGTTAGG - Intronic
1065082892 10:22144724-22144746 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1065930850 10:30477317-30477339 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1069364749 10:67685524-67685546 TATGATTTAGATCCCCTGTTAGG + Intronic
1069939086 10:71941538-71941560 TAAGATTTAAATCCCTTGTTAGG - Intergenic
1071283342 10:84122982-84123004 AAAGATTTAGATCCCCAGTTAGG + Intergenic
1071327176 10:84529051-84529073 TAATATTTAAATCTCCTGTTAGG + Intergenic
1071835204 10:89411179-89411201 TAAGATTTAGATCCCCTGTTAGG - Intronic
1072334607 10:94386427-94386449 TAAGATTTAGATCCCCTGTTGGG - Intergenic
1072391950 10:94996454-94996476 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1072472140 10:95722785-95722807 TAAGATTTAAATCCCCTGTTAGG + Intronic
1074613270 10:115041115-115041137 TAAGATTTAGATTCCCTGTTAGG - Intergenic
1074685440 10:115958357-115958379 AAAGATTTAAATGCCCTGTGTGG - Intergenic
1074742431 10:116498269-116498291 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1075146798 10:119889277-119889299 TAAGATTTAGATCCCCTGTTAGG - Intronic
1075624047 10:123948843-123948865 TAAGATGCAGATCCCCAGCTTGG + Intergenic
1078991366 11:16649611-16649633 CAAGATTTAGAACTCCTTTTGGG - Intronic
1079811190 11:25001454-25001476 TAAGATTTAGATCCCCTGTTAGG + Intronic
1079933983 11:26595700-26595722 TAAGATTGAAATCCCCTGTTAGG + Intronic
1081033659 11:38115488-38115510 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1081070402 11:38603525-38603547 TAAGATCTAAATCCCTCGTTAGG - Intergenic
1081146353 11:39565586-39565608 TAAGATTTAGATCCCTTGTTAGG - Intergenic
1081242226 11:40721165-40721187 TAAAATCTAGATCCCCAGTGCGG + Intronic
1082228631 11:49738536-49738558 TACGATTTAGACCACCTATTTGG + Intergenic
1083089736 11:60187324-60187346 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1085239640 11:75041963-75041985 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1085696458 11:78708916-78708938 TAATAATTAGTTCCCCTTTTTGG + Intronic
1086317880 11:85612282-85612304 TAAGATTTAGATCCCTTGTTGGG - Intronic
1086621441 11:88890617-88890639 TACGATTTAGACCACCTATTTGG - Intronic
1086973590 11:93108982-93109004 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1086987282 11:93264006-93264028 TTAGATTTGGATCCCCTGTTTGG - Intergenic
1087458781 11:98420998-98421020 TAAGATCTAGATCACCTGTTAGG + Intergenic
1087640208 11:100748432-100748454 GAAGATTTAGATCCCCTGTTAGG + Intronic
1087894657 11:103573925-103573947 TAAGACTTAGATCCCCTATTAGG - Intergenic
1090323895 11:125868397-125868419 TTAGATTTGGATCCCCTGTTAGG + Intergenic
1091814657 12:3428163-3428185 TAAGATTTAGATCTCCTGCTGGG + Intronic
1092469689 12:8766750-8766772 TAAGATTTAAATCCCCTGTTAGG + Intronic
1093356569 12:18174438-18174460 TAAGATTTAGATCCCCTGTTAGG - Intronic
1093594286 12:20943025-20943047 TAAGATTTAGATCGCCTGTTAGG + Intergenic
1094319529 12:29170323-29170345 TAAGATTTAGATCCCCTGTTAGG + Intronic
1094771135 12:33661074-33661096 CAAGGTTTAGCTCCCCTGTGAGG + Intergenic
1095138809 12:38638281-38638303 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1095475934 12:42587785-42587807 TAAGTTTAAAATCCCCTGGTGGG + Intronic
1096352313 12:50910561-50910583 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1097377505 12:58857633-58857655 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1097757091 12:63418460-63418482 TTAGATTTAGATCTGCTATTAGG - Intergenic
1098248246 12:68542174-68542196 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1098661185 12:73095663-73095685 TGAGATGTAGATCTCCAGTTGGG - Intergenic
1099104962 12:78486048-78486070 TAAGATTTTGATGGACTGTTGGG - Intergenic
1099124114 12:78731072-78731094 TGAGATTTAGAAGCCATGTTAGG - Intergenic
1099576626 12:84391520-84391542 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1100375407 12:94011071-94011093 TGACCTTTAGATCCCCAGTTGGG + Intergenic
1100424899 12:94475210-94475232 TATGAAATGGATCCCCTGTTTGG + Intergenic
1102606148 12:114068915-114068937 TTAGATTTGGATTCTCTGTTAGG - Intergenic
1104851721 12:131878854-131878876 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1105225522 13:18427925-18427947 TTAGATTTGGATCCCCTATTAGG - Intergenic
1106163189 13:27218575-27218597 TCAAATTTAGATCCCCTGTTAGG - Intergenic
1106607617 13:31244551-31244573 TAAGATTTAGATCTCCTTAAAGG - Intronic
1107009804 13:35657844-35657866 TAAGAAATAAATCCCCTTTTTGG - Intronic
1108318631 13:49264047-49264069 TAAGATTTAAATAAACTGTTAGG + Intronic
1108515839 13:51201733-51201755 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1108849077 13:54705988-54706010 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1108876443 13:55055724-55055746 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1109909673 13:68892862-68892884 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1109931530 13:69223576-69223598 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1110173065 13:72525198-72525220 TAAGATTTATATGCCCATTTAGG + Intergenic
1110183415 13:72644294-72644316 AAAGATTTAGACCCCTTCTTTGG - Intergenic
1110340755 13:74387401-74387423 TAAGACTTAGAGCTCCTTTTAGG + Intergenic
1111021683 13:82459250-82459272 TAAGATTTAAATCCCCTGTAAGG - Intergenic
1111806010 13:93041269-93041291 TAAGATTTAAATCCCTCATTAGG - Intergenic
1111975876 13:94967432-94967454 TTACATTGAAATCCCCTGTTGGG + Intergenic
1113074593 13:106455316-106455338 GAAGATCCAGATCCCCTGTGGGG + Intergenic
1113525275 13:110969780-110969802 TTAGATTTGGATTCCCTGTTAGG - Intergenic
1114236270 14:20826823-20826845 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1114384086 14:22238356-22238378 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1114692144 14:24593918-24593940 CAAGATTTAGAGCTCCTTTTAGG + Intergenic
1115211087 14:30967828-30967850 TAAGATTTCAATCTCCTGTTAGG - Intronic
1115285112 14:31707158-31707180 TAAGATTTAGATGTCCTGTTAGG + Intronic
1115732734 14:36288518-36288540 TAAAATTTACATCTCCTGCTTGG - Intergenic
1117545029 14:56786422-56786444 TTAGATTTTGATGACCTGTTTGG + Intergenic
1117955379 14:61119349-61119371 TAAGATTGAGATCCCTTATTAGG + Intergenic
1120089103 14:80310440-80310462 AAAGATAAAGATCCCCTGTCAGG - Intronic
1122382516 14:101318860-101318882 TTAGATTTGGATCTCCTATTAGG - Intergenic
1125679985 15:41524433-41524455 TCACATTTAAATTCCCTGTTGGG - Intronic
1125690090 15:41589010-41589032 ATAGATTTGGATTCCCTGTTAGG - Intergenic
1126564473 15:50080759-50080781 TAAGGTGTTGTTCCCCTGTTAGG + Intronic
1128362863 15:66974848-66974870 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1133960649 16:10489999-10490021 TTAGATTTATATCCCCTGTTAGG - Intergenic
1135339172 16:21631667-21631689 TAAGATTTAGATCCCCTGTTAGG + Intronic
1137041736 16:35619407-35619429 TAAGATTTAGAGCCCCTGTTAGG + Intergenic
1138257672 16:55581135-55581157 AAAGATCAAGATCCTCTGTTGGG - Intronic
1139399977 16:66673766-66673788 TAAAATGTCAATCCCCTGTTTGG - Intronic
1141249074 16:82338558-82338580 TAGGACCCAGATCCCCTGTTGGG - Intergenic
1143135466 17:4710322-4710344 AAAGACTTAGATCCCCTGGAAGG + Intergenic
1144338875 17:14297013-14297035 TAAGATTTTGACGCCCTGGTTGG - Intergenic
1146764000 17:35502492-35502514 TAAGATTTAGATCCCCTGTTGGG - Intronic
1148827292 17:50403261-50403283 TAAGATTTAAATTCCCTGTTAGG + Intergenic
1148829113 17:50418558-50418580 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1149274319 17:55016716-55016738 TAAGATTTAAATCCCCTGTAAGG + Intronic
1152453548 17:80399188-80399210 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1153401011 18:4683751-4683773 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1153420942 18:4904336-4904358 TTAGTTTTAAATACCCTGTTGGG - Intergenic
1153438278 18:5089450-5089472 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1153826567 18:8880725-8880747 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1153830241 18:8915536-8915558 TATGATTTGGATCCCCTATTAGG - Intergenic
1154527853 18:15311597-15311619 TTATATTTGGATCCCCTATTAGG + Intergenic
1155510493 18:26571432-26571454 TCAGATTTTGATATCCTGTTGGG - Intronic
1155746358 18:29360527-29360549 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1155784030 18:29875485-29875507 TTAGATTTGGATTCCCTGTTAGG - Intergenic
1158718942 18:59906225-59906247 TAAGATTTAGAATCAATGTTTGG - Intergenic
1160209828 18:76867994-76868016 TAACATTTATTTCACCTGTTTGG - Intronic
1161597741 19:5159982-5160004 TAGGATTTAGATCCCCTATTAGG + Intronic
1161830405 19:6598738-6598760 TAAGATTTAGATCCCCTGTTAGG - Intronic
1162108376 19:8385223-8385245 TAAGATTTAGATCTCCTGTTAGG - Intronic
1163867242 19:19784345-19784367 TAAGATTTAGATGCCCTGTTAGG + Intergenic
1163900911 19:20099509-20099531 GAAGATTTAAATCCCCTGTTAGG + Intronic
1163929153 19:20372080-20372102 TAAGGTTTAGACTCCCTGTTGGG - Intergenic
1163991654 19:21004207-21004229 TAAGATTTAGACCCCCTGTTAGG - Intergenic
1164057118 19:21631189-21631211 TAAGATTTAAATCCCCTGTGAGG - Intergenic
1164121715 19:22271730-22271752 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1164130870 19:22360596-22360618 TAAGATTTAGATCCCCCATTAGG + Intergenic
1164173402 19:22747148-22747170 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1164217480 19:23162357-23162379 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1164504130 19:28844355-28844377 TTAGAATTAGCTCCCTTGTTAGG - Intergenic
1164992562 19:32695000-32695022 TCAGATTTAGATCCCCTGTTAGG + Intronic
1165874635 19:38997422-38997444 TAACATTTAAATGACCTGTTCGG + Intronic
924974280 2:158692-158714 TAAGATTTAAATCCCCTGTTAGG + Intergenic
926471053 2:13258978-13259000 GAAGATTTAGAAACCCTGTCTGG + Intergenic
926864225 2:17340918-17340940 TAAGTTTTAAATCCCCTGTTAGG - Intergenic
928476287 2:31630813-31630835 TAAGATTTAAATCCCCTGTTAGG - Intergenic
928676886 2:33659271-33659293 TAAGATTTAAATCCGCTGTTAGG - Intergenic
929051787 2:37843207-37843229 TAAGATTTGAATCCTCAGTTTGG - Intergenic
929656679 2:43739632-43739654 TAAGCTTCAGATTCCCTCTTGGG - Intronic
930760927 2:55035004-55035026 TCAGATTTATCTCCTCTGTTGGG - Intronic
931214034 2:60225062-60225084 AAAGGTTTAGAGCCCCTGTAGGG - Intergenic
931540798 2:63327033-63327055 TAAGATTTAGATCCCCTGTTAGG - Intronic
932917427 2:75873720-75873742 TAAGATTTAAAACCCCTGTTAGG - Intergenic
933175492 2:79168500-79168522 TAAGATTTAAATCTCCTGTAAGG + Intergenic
933342374 2:81039231-81039253 TAAGATTTAGATCCCCTGTTAGG - Intergenic
933389696 2:81654095-81654117 TTAGATTTGGATTCTCTGTTAGG + Intergenic
934672168 2:96221371-96221393 TGAGATTTAAATCCCCTATTAGG + Intergenic
934867585 2:97826923-97826945 TAAGATTTAGATCCCCTGTTAGG - Intronic
935048181 2:99500366-99500388 TAAGATTTAGATCCCCTGTTAGG - Intergenic
935247883 2:101235039-101235061 TAAGATTTAGATCCCCTGTTAGG - Intronic
935337688 2:102032503-102032525 TAAGTTCTAGATCTCATGTTAGG + Intergenic
935647798 2:105355290-105355312 TAAGATTTACATCCCCAGGAAGG + Intergenic
935748600 2:106211043-106211065 TAAGATTTAAATTGCCTGTTAGG - Intergenic
936387476 2:112043063-112043085 TGATATTTAAATCCCCTGTTAGG + Intergenic
936716592 2:115193944-115193966 TACGATTTGGATCCCCTGTTAGG + Intronic
937411521 2:121680997-121681019 TAAGATTTAGATCCCCTGTTAGG + Intergenic
938526951 2:132143053-132143075 TTAGACTTGGATCCCCTATTAGG + Intergenic
938805725 2:134805651-134805673 TAAGACTTAGATCCTCTGTTAGG + Intergenic
939493837 2:142905499-142905521 TAAGATTTAAATCCCCTGTTAGG + Intronic
939824695 2:147000186-147000208 TAAGATTTAAATCCCCTGTTAGG - Intergenic
940236579 2:151517427-151517449 CATTATTTAGGTCCCCTGTTGGG - Intronic
940352579 2:152705728-152705750 TTAGATTTGGATCCCCTGTTAGG - Intronic
941243746 2:163071706-163071728 TAAGATTTAGATCCCCTATTAGG - Intergenic
941537344 2:166740190-166740212 TAAGATTTAGGTCCCCTGTTAGG + Intergenic
942101920 2:172592064-172592086 TCAGATTTAGATCCCCTGTTAGG + Intronic
942830627 2:180234729-180234751 TAAGATTTAAATTCCCTGTTAGG - Intergenic
943102844 2:183508921-183508943 TAAGATTTAGATCGCCTGTTAGG + Intergenic
943134217 2:183891180-183891202 TAAGATTTAGATCCTCTGTTGGG - Intergenic
943407948 2:187512414-187512436 TAAGATTTAAATCCCCTGTTAGG - Intronic
944039502 2:195337895-195337917 TAAGATTTAAATCCCCTGTTAGG + Intergenic
945720111 2:213408570-213408592 TAAGATTTAAATCCCCTGTTAGG - Intronic
1168823954 20:796328-796350 TTAGATGTGGATTCCCTGTTAGG - Intergenic
1171261829 20:23740866-23740888 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1171270964 20:23816746-23816768 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1171985129 20:31654861-31654883 TAAGATTGATATACCCTTTTGGG + Intergenic
1172340884 20:34156506-34156528 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1174994087 20:55546003-55546025 TAAGAATTAGAGCCCCAGATGGG - Intergenic
1175513994 20:59557055-59557077 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1176769574 21:13056948-13056970 TTAGATTTGGATCCCCTATTAGG - Intergenic
1177263749 21:18758523-18758545 TAAGATTTAAATCCTCTGTTAGG + Intergenic
1177895985 21:26856529-26856551 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1178109542 21:29356617-29356639 TAAGATTTAGATCCCCTGTTAGG + Intronic
1178836931 21:36106243-36106265 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1182311813 22:29414686-29414708 TAAGATTTAAATCCCCTGTTAGG + Intronic
1182688455 22:32138618-32138640 TAAGATTTAAATTCCCTGTTAGG - Intergenic
1183125586 22:35777310-35777332 TAAAATTTATTTCCCCTATTAGG - Intronic
1184943712 22:47786390-47786412 CAAGATCAAGATCTCCTGTTGGG + Intergenic
949610168 3:5696161-5696183 TTTGATATAGATCCCCTGTTAGG + Intergenic
949611365 3:5707020-5707042 TAAGATTTACATCCCCTGTTAGG + Intergenic
950594774 3:13970086-13970108 CTAGATTTGGATCCCCTGTTAGG + Intronic
951020969 3:17780483-17780505 TAAGATTTAGATCCCCTGTTAGG - Intronic
951200949 3:19874936-19874958 TAAGATTTAAATCCTTTGTTAGG + Intergenic
951239809 3:20274550-20274572 TAAGATTTAGATCCCCTGTTAGG - Intergenic
952554841 3:34520294-34520316 TAAGACATAGATCCCTTGTTAGG + Intergenic
952922457 3:38295191-38295213 TAAGATTTAAATCCCCTGTTAGG + Intronic
952940484 3:38440569-38440591 TAAGCTTTAGATCTCCTGTCAGG + Intergenic
953622479 3:44545057-44545079 TAAGATTCAGATCCCCTGTTAGG + Intergenic
954096686 3:48334199-48334221 TAAGATTTAAATCCCCTGTTAGG + Intergenic
954599263 3:51855061-51855083 TAAGATTTAGATCCCCTGTTAGG - Intergenic
954604556 3:51898733-51898755 TAAGATTTAGATCCCCAGTTAGG - Intronic
956194603 3:66639820-66639842 TAAGATTTTGATGCCCTTTCTGG + Intergenic
956842613 3:73154584-73154606 TAAGATTTAGATCCCCTGTTAGG + Intergenic
958000057 3:87739264-87739286 TAAGATTTAAATCCCTTGTTAGG + Intergenic
958016497 3:87944565-87944587 TAAGATTTAAATCCCCTGTTAGG + Intergenic
958453196 3:94298968-94298990 TTAGTTTTAAATTCCCTGTTTGG - Intergenic
958601565 3:96301514-96301536 TAAGATTTAGATCCCCTGTTAGG - Intergenic
958630041 3:96672605-96672627 TAAGATTTAAGTTCCCTGTAAGG + Intergenic
959352541 3:105284163-105284185 TAGAATTAAGATGCCCTGTTTGG + Intergenic
960720523 3:120621090-120621112 TACGATTTAGATCCCCTGTTAGG + Intergenic
962097219 3:132304527-132304549 TAAGATTTAGATCCCCTGTTAGG - Intergenic
963021590 3:140877207-140877229 TCAGATTTAGATCCCATGTTAGG - Intergenic
963697204 3:148576566-148576588 TAAGATTTAGATCCACTGTTAGG - Intergenic
963915544 3:150856000-150856022 TAAGATTTAAATCACCTGTAAGG - Intergenic
963991833 3:151665124-151665146 TAAGATTTAGATCACCTATTAGG + Intergenic
964933207 3:162050694-162050716 TAAGATTTAGATCCCCTGTTAGG + Intergenic
964953188 3:162323012-162323034 TAAGATTTAAATCCCTTGATAGG - Intergenic
964972463 3:162578583-162578605 TAAGACTTTGATCCCCTGTTAGG - Intergenic
965054964 3:163699872-163699894 TAATATTTAAATCCCCTGTTAGG + Intergenic
965139673 3:164817276-164817298 TAAGATTTAGATCCCCTGTTAGG - Intergenic
967582247 3:191172711-191172733 TAGAATTTAGATCCCATTTTTGG - Intergenic
967584132 3:191191596-191191618 TGAGATTTAGATCTCCTGTTAGG - Intergenic
967623345 3:191660453-191660475 TAAGTCTTAAATCCCCGGTTAGG - Intergenic
968391348 4:195456-195478 TAAGATTTAAATCCCCTGTTAGG + Intergenic
970092837 4:12429404-12429426 TAAGATTTAGATCGCCTGTTAGG + Intergenic
972374593 4:38458721-38458743 TAAGATTTGGATTCCCTGGAGGG - Intergenic
972623401 4:40771318-40771340 TAAAATGTAGCTCCCATGTTAGG - Intronic
972651308 4:41020273-41020295 TAAGATTTAGATCCCCTGTTAGG - Intronic
972991481 4:44826750-44826772 TAAGATTTAGATCTCCTGATAGG + Intergenic
974195844 4:58574181-58574203 TAAAATATAGATCCCATGTTAGG - Intergenic
975169868 4:71221392-71221414 TAAGAATGACATCCCGTGTTTGG - Intronic
975205503 4:71640156-71640178 TAAGATTTACATCCCCTGTTAGG - Intergenic
975314087 4:72932072-72932094 TAAGATTTAAATCCCCTGTTAGG + Intergenic
976189593 4:82475653-82475675 TAAGATTTAAATCCCCTGTTAGG - Intergenic
977043722 4:92044268-92044290 TAAGATTTAGATGCCCTGTTAGG + Intergenic
977618184 4:99108009-99108031 TAAGATTTAAATCCCTTTTTAGG + Intergenic
977640641 4:99354683-99354705 TAAGATTTAGATCCCCTGTTAGG - Intergenic
977834480 4:101632535-101632557 TAAGATTTAGATCCCCTGTTAGG + Intronic
977972222 4:103225577-103225599 TAAGATTTAGATCCCCTGTTAGG - Intergenic
978314002 4:107415815-107415837 TAAGATTTAGATCCCATGTTAGG - Intergenic
978752356 4:112264537-112264559 TAAGATTTAGAAGAACTGTTGGG - Intronic
978909291 4:114046280-114046302 TAAGATTTAAATCCCCTGTTAGG - Intergenic
980444065 4:132884230-132884252 TAAGATTTAAATCCCCTGTTAGG - Intergenic
980501253 4:133657095-133657117 TTAGAGTTATATCCCCTGTTTGG - Intergenic
981177570 4:141700271-141700293 TAAGATTTAGAACTTCTTTTAGG + Intronic
982701595 4:158663816-158663838 TCAGATTTAGATCTCCTATTAGG - Intergenic
982877499 4:160666327-160666349 TAAGATTTAGGTCCCTTGTTAGG - Intergenic
983159366 4:164392508-164392530 TAATATTTAGATTCCTTGTTTGG - Intergenic
983667173 4:170195145-170195167 TAAGATTTAAATCCCCTGTTAGG + Intergenic
983708239 4:170684716-170684738 TAAGATTTAAATCCCCTGTTAGG - Intergenic
983834473 4:172371291-172371313 TAAGATTTAGATCCCCTGTTAGG + Intronic
985378583 4:189368429-189368451 TCAGATTTAAATCTTCTGTTGGG - Intergenic
985823075 5:2173783-2173805 GAAGATTTAGATGGCCTGCTGGG + Intergenic
987931038 5:24399487-24399509 TAAGATTTAGATCCCCTGTTAGG - Intergenic
988049057 5:25999811-25999833 TAACATTTAGATGCCCTTTGAGG + Intergenic
988358230 5:30203477-30203499 TAAGATTTAGATCCCCTGTTAGG - Intergenic
988457264 5:31397316-31397338 TAAGATTTAAATCCCTCGGTAGG + Intergenic
988740255 5:34062734-34062756 AAAGATTTAAATCCCCTGTTAGG + Intronic
989096197 5:37783943-37783965 TAAGATTTAGATCCCCTGTTAGG + Intergenic
989964161 5:50449520-50449542 TAAGATTTAGATCCCCTGTTAGG + Intergenic
990117054 5:52402266-52402288 TAAGATTTAGATCCCCTGTTAGG - Intergenic
990249711 5:53900970-53900992 TAAGAATTAGATGCTTTGTTTGG - Intronic
990367546 5:55086291-55086313 TAAGATTTAGATCCCCTGTTAGG + Intergenic
990419369 5:55616409-55616431 TAAGATTTAGATCCCCTGTTAGG - Intergenic
990892086 5:60660794-60660816 TAAGATTTAAATCCTCTGTTAGG - Intronic
991305916 5:65175766-65175788 TAAGATTTAGATCCCCTGTAAGG - Intronic
992293744 5:75306306-75306328 TAAGATTGAAATCCCTTGTTGGG - Intergenic
992455650 5:76913229-76913251 TAAGATTTAGATCCCCTGTTAGG - Intronic
993055356 5:82974185-82974207 TAAGATTTAGATCCCCTGTTAGG + Intergenic
993952655 5:94195488-94195510 ACAGATTTAGGTTCCCTGTTGGG + Intronic
995228328 5:109728936-109728958 TAAAATTTGGATCCCCTATTAGG + Intronic
995465418 5:112445713-112445735 TAAGATTTAAATCACCTGTTAGG - Intergenic
996098904 5:119427931-119427953 TAAGATTTACATCCCCTGTTAGG + Intergenic
996100315 5:119438654-119438676 TATGATTTAGATCCCCTGTTAGG - Intergenic
996429666 5:123359055-123359077 AAAGATTTACATCCCATGCTTGG + Intronic
996878412 5:128265232-128265254 TCTAATTTAGATTCCCTGTTAGG - Intronic
997105800 5:131018243-131018265 TAAGATTTAGAGTTCCTTTTAGG + Intergenic
997756282 5:136402593-136402615 TAAGATATGGATGCCCAGTTAGG - Intergenic
998552717 5:143093018-143093040 TAAGATTTAGATCCCCTGTTAGG + Intronic
998800984 5:145868830-145868852 TAAGTTTTAGTTACCCTGATAGG + Intronic
998938831 5:147259103-147259125 AGGGATTTAGATCCCCTGTTAGG + Intronic
999499712 5:152134616-152134638 CAATATTGAGATCCCCTCTTAGG - Intergenic
1000236681 5:159368014-159368036 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1001558608 5:172654460-172654482 TAAGACTTAGATCCCCTGTTAGG + Intronic
1002999273 6:2316237-2316259 TTAGATTTAGATCCCCTATTAGG + Intergenic
1003697412 6:8424070-8424092 TTGGATTTAGTTCCCCTGTCAGG - Intronic
1003805994 6:9726411-9726433 TAAGATTTAGATCCCCTGTTAGG - Intronic
1004236603 6:13880167-13880189 TAAGATTTAAATCTCCTGTTAGG - Intergenic
1004812699 6:19277077-19277099 TCAGATTTAGATACCCTGTTAGG - Intergenic
1005323896 6:24681054-24681076 TAAGATTTAAATCCTTTGTTAGG + Intronic
1005461781 6:26075880-26075902 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1006222042 6:32499405-32499427 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1008123323 6:47642327-47642349 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1008582531 6:52919884-52919906 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1009544550 6:65006631-65006653 TAAGATTTAAATCCCCCATTAGG - Intronic
1009635611 6:66260714-66260736 TAAGATTTAAATCCTCTGTTAGG - Intergenic
1010075275 6:71790615-71790637 TAAAATTTAGATCCCCTGTTAGG - Intergenic
1010893267 6:81339024-81339046 TAAAATTTAAATCCCTTGTTAGG - Intergenic
1011450022 6:87482700-87482722 TAAGATTTAGATCCCCTGTGAGG + Intronic
1011540134 6:88419700-88419722 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1011570198 6:88726515-88726537 TAAGATTTAGATCCCATGTTAGG - Intronic
1013022012 6:106230000-106230022 TAAGATTTAAATCCCCTGTAAGG - Intronic
1013543316 6:111132710-111132732 TAAGATTTAAATCCCCTGTTAGG - Intronic
1013977619 6:116095121-116095143 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1015171802 6:130262482-130262504 TAAGATTTAAATCCCTTGTTAGG - Intronic
1016343416 6:143085883-143085905 TAAGATTTAAATCCCCTGTTAGG + Intronic
1018191553 6:161313785-161313807 TAAGATTTAGATGCCCTGTTAGG + Intergenic
1018760806 6:166892922-166892944 TAAGATTTAAATCCTTTGTTGGG - Intronic
1020044035 7:5027027-5027049 TAAGATTTAGATCCCCTGTTAGG + Intronic
1020745197 7:12071177-12071199 TTAGATTTGGATCCCCTGTTAGG - Intergenic
1021356144 7:19655198-19655220 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1021756278 7:23856195-23856217 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1022489992 7:30809445-30809467 TAAGATTTAGATCCCCTGTTAGG - Intronic
1023077759 7:36500699-36500721 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1023439509 7:40171482-40171504 TAAGATTTAAATCCCCTGTTAGG + Intronic
1023798471 7:43813119-43813141 TGAGATTTAGATACCCTGTTAGG - Intergenic
1024532169 7:50402299-50402321 TGAGACTAAGAACCCCTGTTTGG - Exonic
1025798261 7:64759913-64759935 TAAGGTTTAGATCCCCTGTTAGG + Intergenic
1026657038 7:72265809-72265831 CAGTATTTAGATCACCTGTTGGG + Intronic
1028333812 7:89626868-89626890 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1028793586 7:94879686-94879708 TAAGATTTAGATCGCCTGTTAGG - Intergenic
1029539993 7:101177154-101177176 GAGGATTTAGATCCTCTGCTGGG + Intronic
1030337067 7:108339146-108339168 TAAGATTTAAATCTCCTGTTAGG - Intronic
1030420707 7:109303286-109303308 TAAGATTTAGATACCCTGTTAGG - Intergenic
1030843753 7:114384612-114384634 TAAGATTTAAATCCCTTGTTAGG + Intronic
1031471257 7:122172035-122172057 TAAGATTTAAATCCCTCATTAGG - Intergenic
1032426286 7:131824715-131824737 TAAGATTTAAATCCCTCATTAGG + Intergenic
1032725597 7:134587650-134587672 TAAAATTTAAATCCCCTGTTAGG - Intergenic
1033654591 7:143363854-143363876 TAAGACTTAGCCTCCCTGTTAGG - Intergenic
1034249028 7:149673521-149673543 TAAGATTTAAATCCCCTGTTAGG - Intergenic
1034579443 7:152029840-152029862 TAAGATTTAGATCCCCTGTTAGG + Intronic
1037570824 8:20156379-20156401 TAAGATTAAAATCCCCTGTTAGG - Intronic
1038089509 8:24237445-24237467 TAAGATTTAGATCTCCTGTTGGG - Intergenic
1039276407 8:35937701-35937723 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1039876975 8:41595255-41595277 TAAGATTTAGATCTCCTGTTAGG + Intronic
1041226745 8:55707761-55707783 AAAGATTTAGATCCCCTGTTAGG - Intronic
1041533761 8:58902653-58902675 AAAGATTTATATCCCATTTTTGG - Intronic
1042055934 8:64764888-64764910 TGAGATTTAAATCCCCTGTTAGG - Intronic
1043613396 8:82093590-82093612 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1044184824 8:89239006-89239028 TAAGATTTAGATTCCCAGTTAGG + Intergenic
1044190078 8:89305358-89305380 CCAGTTTTAGATCTCCTGTTAGG + Intergenic
1044456214 8:92395240-92395262 TCAGATTTAGATCCTTTGTTAGG + Intergenic
1046232366 8:111374112-111374134 TAAGATTTGACTCCCCTATTGGG + Intergenic
1047444120 8:124904499-124904521 TAAGATTTAAACACCCTGTTAGG + Intergenic
1049877489 8:145034707-145034729 ATTAATTTAGATCCCCTGTTAGG - Intergenic
1050083720 9:1942084-1942106 TTAGATGTAGAACCCCTGGTTGG + Intergenic
1052289958 9:26829245-26829267 TAAGATTTAGATCCCATGTTAGG - Intergenic
1052507929 9:29379042-29379064 TAAGATTTAGATCCCTTGTTAGG - Intergenic
1052529153 9:29658487-29658509 TAAGATTTAAATCCCTTATTAGG + Intergenic
1052538674 9:29778916-29778938 TAAGATTTAAATCCCTCATTAGG + Intergenic
1053110963 9:35459838-35459860 TAAGATTTAAATCCCCAGTTAGG + Intergenic
1055457975 9:76490860-76490882 TAAGATTTAGATCCCCTGTAAGG + Intronic
1056704782 9:88942706-88942728 TAAGATTTAAATCCCCTATTAGG + Intergenic
1061471704 9:130831909-130831931 TAAGATGGAAATCCACTGTTTGG - Intronic
1061787124 9:133036209-133036231 TTAGATTTGGATTCCCTGTTAGG + Intronic
1203625966 Un_KI270750v1:22220-22242 TAATATTTTGTTCTCCTGTTTGG - Intergenic
1186254274 X:7702109-7702131 TAAGATTTAAATCCCCTGTAAGG + Intergenic
1186699013 X:12069493-12069515 AAAGATGTATATCCACTGTTTGG - Intergenic
1187942021 X:24391781-24391803 GAAGTTTGAGATCCACTGTTTGG - Intergenic
1188097982 X:26046050-26046072 TAAGATTTAGAACCCCTGTTAGG - Intergenic
1188136959 X:26503285-26503307 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1189034394 X:37480684-37480706 TAAGATTTAGATCCCCTGTTAGG - Intronic
1190270065 X:48855625-48855647 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1190771069 X:53514589-53514611 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1191167247 X:57403829-57403851 TAAGATTTAAATCCCCTGTTAGG + Intronic
1191890081 X:65930959-65930981 TAAGATTTAGATCCTCTGTTAGG + Intergenic
1191918125 X:66224419-66224441 TAAGATTTAGTTCCCCTGTTAGG + Intronic
1192915623 X:75648481-75648503 TAAGATTTAGATCTCCTGTTAGG + Intergenic
1192940130 X:75903181-75903203 TAAGATTTAAATTCCCTGTTAGG + Intergenic
1193172126 X:78348641-78348663 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1193306483 X:79957770-79957792 TAAGATTTAAATTCCCTGTTAGG - Intergenic
1193717184 X:84946608-84946630 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1195591680 X:106635821-106635843 TAATAATTAGATAGCCTGTTAGG + Intronic
1195847077 X:109240358-109240380 TAAGATTTAAATCCCCTGTTAGG + Intergenic
1195850724 X:109279160-109279182 TTAGGATTAAATCCCCTGTTAGG + Intergenic
1196126925 X:112110911-112110933 TAAGATTTAGATCCCTTGTTAGG + Intergenic
1196460238 X:115922303-115922325 TAAGACTTAGATGCCCTGTTAGG + Intergenic
1197034483 X:121857801-121857823 CAAGATTTAGAACTCCTCTTAGG + Intergenic
1198742301 X:139853961-139853983 TAAGATTTAGATACCCTGTTAGG - Intronic
1199278391 X:145972069-145972091 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1199637604 X:149828149-149828171 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1200711571 Y:6489384-6489406 TAAGACTTAGATCCCCTGTTAGG - Intergenic
1200763444 Y:7060962-7060984 TAAGATTTAGATAACCTGTTAGG + Intronic
1200880413 Y:8206678-8206700 TAAGACTTAGATCCCCTGTTAGG + Intergenic
1200945506 Y:8831414-8831436 TAAAATTTAGATCCCCTTTTAGG - Intergenic
1201022363 Y:9672595-9672617 TAAGACTTAGATCCCCTGTTAGG + Intergenic
1201308143 Y:12568923-12568945 AAAGATTTAGATCACCTCTTAGG - Intergenic
1201568201 Y:15388022-15388044 CCAGATTTAGATCCCCTATTAGG + Intergenic
1201648578 Y:16261993-16262015 TAAGATTTAGATCCCCTGTTAGG + Intergenic
1201654232 Y:16323308-16323330 TAAGATTTAGATCCCCTGTTAGG - Intergenic
1201900075 Y:19040075-19040097 TAAGGTTTAGATCCCCTGTTAGG + Intergenic
1201905445 Y:19081924-19081946 TAAGATTTAAATTCCCTGTTAGG - Intergenic
1202192212 Y:22257189-22257211 TAAGATTTAGATCCCCTGTTAGG + Intergenic