ID: 988358232

View in Genome Browser
Species Human (GRCh38)
Location 5:30203508-30203530
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 41, 1: 115, 2: 101, 3: 52, 4: 54}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988358232_988358236 -3 Left 988358232 5:30203508-30203530 CCATACAAAGGTCCGACCAGACC 0: 41
1: 115
2: 101
3: 52
4: 54
Right 988358236 5:30203528-30203550 ACCTAGGAGAAACTCCCTTCAGG No data
988358232_988358242 13 Left 988358232 5:30203508-30203530 CCATACAAAGGTCCGACCAGACC 0: 41
1: 115
2: 101
3: 52
4: 54
Right 988358242 5:30203544-30203566 CTTCAGGACAGAAGGATGGATGG No data
988358232_988358243 24 Left 988358232 5:30203508-30203530 CCATACAAAGGTCCGACCAGACC 0: 41
1: 115
2: 101
3: 52
4: 54
Right 988358243 5:30203555-30203577 AAGGATGGATGGTTCCTCCCAGG No data
988358232_988358238 5 Left 988358232 5:30203508-30203530 CCATACAAAGGTCCGACCAGACC 0: 41
1: 115
2: 101
3: 52
4: 54
Right 988358238 5:30203536-30203558 GAAACTCCCTTCAGGACAGAAGG No data
988358232_988358239 9 Left 988358232 5:30203508-30203530 CCATACAAAGGTCCGACCAGACC 0: 41
1: 115
2: 101
3: 52
4: 54
Right 988358239 5:30203540-30203562 CTCCCTTCAGGACAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988358232 Original CRISPR GGTCTGGTCGGACCTTTGTA TGG (reversed) Intergenic
901946613 1:12709293-12709315 AGTCTGGTTGAACCTTTGTGTGG + Intergenic
902031929 1:13429245-13429267 GATCTGGTCGGACCTTTGTATGG - Intergenic
902051807 1:13569092-13569114 GGTCTGGTCGGACCTTTGTATGG - Intergenic
904571293 1:31467762-31467784 GGTCTGGTCAGACCTTTGTATGG + Intergenic
904713127 1:32446659-32446681 GGTCTGGTAGGGCCTTTGTATGG + Intergenic
905567783 1:38979612-38979634 GATCTGGTTGGACTTTTGTATGG + Intergenic
906507578 1:46391647-46391669 GGTCTGGTCGGACCTTTGTATGG + Intergenic
906582483 1:46947592-46947614 GGTCTGGTTGGACCTTCGTATGG - Intergenic
906583251 1:46953772-46953794 GGTGTGGTTGAACCTTTGTATGG - Intergenic
906601130 1:47130277-47130299 GATCTGGTTGGGCCTTTGTATGG + Intergenic
906767027 1:48442967-48442989 GGTCTGGTTGGACTTTTGTATGG - Intronic
907037230 1:51227271-51227293 GGTCTGGTCGGACCTTTGTATGG - Intergenic
907505830 1:54917534-54917556 GGTCTGGTTGGACCTTTGTATGG + Intergenic
907602684 1:55786640-55786662 AGTCTGGTTGGACCTTTGTATGG + Intergenic
908300888 1:62760152-62760174 GAGCTGGTTGGACCTTTGTATGG - Intergenic
910590738 1:88926283-88926305 GGTCTGGTCGGACCTTTGTATGG - Intergenic
911299190 1:96152020-96152042 GGTCTGGTCAGACCTTTGCATGG - Intergenic
912464073 1:109857529-109857551 GGTCTGGTTGGACCTTTGTATGG + Intergenic
913470535 1:119181440-119181462 GATCTGGTCAGACCTTTGTATGG + Intergenic
916084137 1:161256231-161256253 GGTCTGGTTAGACCTTTGTATGG - Intergenic
917227796 1:172802507-172802529 GATCTGGTTGGACCTTTGTATGG - Intergenic
917676587 1:177324434-177324456 GGTCTGGTCGGACCTTCGTATGG - Intergenic
919257254 1:195140570-195140592 GATCTGGTCAGACCCTTGTATGG - Intergenic
919559172 1:199096339-199096361 GGTCTGGTCGGACCTTTGTATGG - Intergenic
920425375 1:205870862-205870884 GGTCTGGTCGGACCTTTGTATGG + Intergenic
924859220 1:247904162-247904184 GGTTTGGTCAGACCTTCGTATGG + Intergenic
1063415166 10:5867252-5867274 GGTCTGGTTGGACCTTTGTATGG - Intronic
1064603087 10:17012904-17012926 TGTCTGGTGGGACCTTTGTATGG + Intronic
1065082894 10:22144755-22144777 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1065810343 10:29437406-29437428 GGTTTGGTTGGACCTTTGTATGG + Intergenic
1065930852 10:30477344-30477366 GGTTTGGTTGGACCTTTGTATGG - Intergenic
1068240883 10:54299625-54299647 GATCTGGTCAGACCTTTGTATGG - Intronic
1068791992 10:61039053-61039075 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1069364747 10:67685493-67685515 GGTCTGGTTGGACCTTTGTATGG + Intronic
1069939088 10:71941565-71941587 GGTCTGGTCGGACCTTTGTAAGG - Intergenic
1071283288 10:84122641-84122663 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1071835207 10:89411210-89411232 GATCTGGTCAGACCTTTGTATGG - Intronic
1072378335 10:94839826-94839848 TGTCTGGTCGGACTGTTGTATGG + Intronic
1072391948 10:94996423-94996445 GGTCTGGTTGGGCCTTTGTATGG + Intergenic
1072472138 10:95722758-95722780 GGTCTGGTCGGACCTTTGTATGG + Intronic
1074742429 10:116498238-116498260 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1075146800 10:119889304-119889326 GATCTGGTTGGACCTTTGTATGG - Intronic
1077398329 11:2338304-2338326 GGTCTGGTTGGACCTTTGTATGG - Intergenic
1079255035 11:18820406-18820428 GGTCTGGTTAGACCTTTGTATGG + Intergenic
1081033660 11:38115515-38115537 GGTCTGGTCAGATCTTTGTATGG - Intergenic
1081070403 11:38603552-38603574 GGTCTGGTCAAAACTTTGTATGG - Intergenic
1081146354 11:39565617-39565639 GGTCTGGTTGGACATTTGTATGG - Intergenic
1083089738 11:60187351-60187373 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1083375778 11:62219441-62219463 GATCTGGCCTGACCTTTGTTTGG - Intergenic
1084788461 11:71457940-71457962 GGTGTGGACGGACCTTTTTGGGG + Intronic
1085239642 11:75041990-75042012 CATCTGTTCGGACCTTTGTATGG - Intergenic
1086973588 11:93108955-93108977 GGTCTGGTGGGACCTTTGTATGG + Intergenic
1087458778 11:98420967-98420989 GGTCCGGTCAGACCTTTGCATGG + Intergenic
1087640206 11:100748405-100748427 GGTCTGGTTGGACCTTTGTATGG + Intronic
1087894659 11:103573952-103573974 GGTCTGGTTGGACCTTTGTATGG - Intergenic
1090323893 11:125868352-125868374 GGTCTGGTCAGACTTTTGTATGG + Intergenic
1091814654 12:3428136-3428158 GGTCTGGTCGGACCTTTGTATGG + Intronic
1092469687 12:8766723-8766745 GGTCTGGTCAGACCTTTGTATGG + Intronic
1093594284 12:20942998-20943020 GGTCTGGTTAGACCTTTGTATGG + Intergenic
1094319527 12:29170296-29170318 GGTCTGGTCAGACCTTTGTATGG + Intronic
1095138811 12:38638308-38638330 GGTCTTGTTGGACCTTTGTATGG - Intergenic
1096352310 12:50910534-50910556 GGTCTGGCCGGACCTTTGTATGG + Intergenic
1098248248 12:68542201-68542223 GGTCTGGTTGGACCTTTGTATGG - Intergenic
1100050658 12:90445067-90445089 GATCTGGTCAGACCTTTGTATGG + Intergenic
1104851719 12:131878827-131878849 GGTCTGGTCGGACCTTAGTATGG + Intergenic
1105225525 13:18427982-18428004 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1108515837 13:51201702-51201724 GATCTGGTCGGACCTTCGTATGG + Intergenic
1108849079 13:54706019-54706041 GGTCTGGTAGGACCTTTGTATGG - Intergenic
1108876445 13:55055751-55055773 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1109606890 13:64707770-64707792 GGTCTGGTCGGACTTTTGTGTGG + Intergenic
1109798341 13:67344327-67344349 GGTCTGGTCTGACTTTGGTTTGG + Intergenic
1109931532 13:69223603-69223625 GGTCTGGTCGGACCTTCGTGTGG - Intergenic
1111021685 13:82459277-82459299 GGTCTGCTCGGACCTTCGTATGG - Intergenic
1111806012 13:93041296-93041318 GTTCTGGTTGGACCTTTGTATGG - Intergenic
1111876807 13:93907662-93907684 GGTCTGGTCGCACCTCTGTCTGG - Intronic
1114009976 14:18356333-18356355 GGTCTTGTCAGACCTTTGTATGG - Intergenic
1114236268 14:20826796-20826818 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1114384088 14:22238383-22238405 GGTCTGGTCGGACCTTTGTATGG - Intergenic
1115211088 14:30967855-30967877 GGTCTGGTCGGATCTTTGTATGG - Intronic
1115285110 14:31707131-31707153 GATCTGGTCGGACCTTTGTATGG + Intronic
1116725700 14:48559159-48559181 GGTCTGGTTGGACCTTTGTGTGG - Intergenic
1117179715 14:53179842-53179864 GGTCTGGTTGGACCTTTGTAAGG + Intergenic
1122382519 14:101318917-101318939 GGTCTGGTCATACCTTTGTATGG - Intergenic
1123458206 15:20444634-20444656 GGTCTGGTGGGAGCTATGGAAGG - Intergenic
1123659861 15:22555775-22555797 GGTCTGGTGGGAGCTATGGAAGG + Intergenic
1124264495 15:28220805-28220827 GGTCTGGTGGGAGCTATGGAAGG - Intronic
1124313722 15:28650270-28650292 GGTCTGGTGGGAGCTATGGAAGG + Intergenic
1125690096 15:41589067-41589089 GGTCTGGTCGAACCTTTGTATGG - Intergenic
1128362862 15:66974821-66974843 GGTCTGGTCGGATCTTTGTATGG + Intergenic
1132406819 15:101546749-101546771 GGTCAGGTGGGACCTTTAAAAGG + Intergenic
1133960650 16:10490056-10490078 GGTCTGGTCAGATCTTTGTATGG - Intergenic
1135339170 16:21631640-21631662 TGTCTGATTGGACCTTTGTATGG + Intronic
1137041734 16:35619380-35619402 GGTCTGGTCATACCTTTGTATGG + Intergenic
1139502900 16:67382493-67382515 GATCTGATGGGACCTTTGTTTGG + Intronic
1142319019 16:89369122-89369144 GGTGTGGTTGGTCCTTTCTAGGG - Intronic
1146764003 17:35502519-35502541 GGTCTGGTCGGACCTTTGTATGG - Intronic
1148827290 17:50403234-50403256 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1148829111 17:50418531-50418553 GGTCTGGTTGGACCTTTGTATGG + Intergenic
1149274317 17:55016689-55016711 GGTCTGGTTGGTCCTTTGTATGG + Intronic
1152453550 17:80399215-80399237 GGTATGGTAGGGCCTTTGTACGG - Intergenic
1153401013 18:4683778-4683800 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1153438280 18:5089481-5089503 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1153826565 18:8880694-8880716 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1153830243 18:8915563-8915585 GGTCTGGTCAGACTTTTGTATGG - Intergenic
1154527850 18:15311540-15311562 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1155746357 18:29360496-29360518 GGTCTGGTTGAACTTTTGTATGG + Intergenic
1161597738 19:5159955-5159977 GGTCTGGTCAGACCTTTGTATGG + Intronic
1162108378 19:8385254-8385276 GATCTGGTCAGACCTTTGTATGG - Intronic
1162268036 19:9592135-9592157 GGTCTGGTCGAACCTTTCTATGG + Intergenic
1162625681 19:11882808-11882830 AGTTTGGCCGGACATTTGTATGG - Intronic
1162915596 19:13872991-13873013 GGTCGGGGCGGACCTTAGTGGGG + Intronic
1163217262 19:15890101-15890123 GGTGTGGTCAGAGCTCTGTAGGG - Intronic
1163747198 19:19055583-19055605 GGCCTGGTCAGATCTTTGCAGGG - Intronic
1163867240 19:19784318-19784340 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1163900910 19:20099482-20099504 GGTCAGCTCAGACTTTTGTATGG + Intronic
1163912217 19:20206389-20206411 AGTCTGGTCGAACTTTTGTATGG - Intergenic
1163929156 19:20372107-20372129 GGTCTGGTCAGACTTTTCTATGG - Intergenic
1163991656 19:21004234-21004256 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1164121713 19:22271703-22271725 GGTCTGGTTGGACCTTTGTATGG + Intergenic
1164130868 19:22360569-22360591 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1164173404 19:22747175-22747197 GGTCTGGTTGGACCTTTGTATGG - Intergenic
1164217479 19:23162330-23162352 GGTCTGGTCGGAATTTTGTATGG + Intergenic
1164323301 19:24169763-24169785 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1167906735 19:52666780-52666802 GGCCTGGTCAGACCTTTGCATGG - Intronic
924974279 2:158665-158687 TGTCTGGTTGGATCTTTGTATGG + Intergenic
926503194 2:13679806-13679828 GGTCTGGTCAGACCTCTGTATGG - Intergenic
926864227 2:17340945-17340967 GGTCTGGTGGGACCTTTGTATGG - Intergenic
928476289 2:31630840-31630862 GGTCTGGTCGGACCTTTGTATGG - Intergenic
928676888 2:33659298-33659320 GGTCTGGTCGGACCTTTGTATGG - Intergenic
931540799 2:63327064-63327086 GATTTGGTCAGAACTTTGTATGG - Intronic
932917429 2:75873747-75873769 GTTCTGGTCGGACCTTTGTATGG - Intergenic
933389690 2:81654038-81654060 AGTCTGGTTGAACCTTCGTATGG + Intergenic
934672166 2:96221344-96221366 GATCTGGTCGGACCTTTGTATGG + Intergenic
935048183 2:99500393-99500415 GGTCTGGTTGGACCTTTGTATGG - Intergenic
935247885 2:101235070-101235092 GATCTGGTCGGACCTTTTTATGG - Intronic
935748601 2:106211070-106211092 GGTCTGGTCGGACTTTTGTATGG - Intergenic
936387474 2:112043036-112043058 GGTCTGGCTGGGCCTTTGTATGG + Intergenic
936716589 2:115193887-115193909 GGTCTGGTCGGGCCTTTGTATGG + Intronic
937057423 2:118951267-118951289 GGTCTGGTGGGACCTTTCTATGG + Intronic
937286759 2:120758765-120758787 GGCCTGGCCTGACCTTTGGATGG - Intronic
937411519 2:121680966-121680988 GGTCTGGTCGGACCTTTGTATGG + Intergenic
938526948 2:132142996-132143018 AGTCTGGTCAGACCTTTGTATGG + Intergenic
938805724 2:134805620-134805642 GATCTGGTCAGATCTTTGTATGG + Intergenic
939493835 2:142905472-142905494 GGTCTGGTAGGACCTTTGTATGG + Intronic
940352582 2:152705785-152705807 GGTCTGGTCAGACATTTGTGTGG - Intronic
941243747 2:163071737-163071759 GATCTGGTCGGATCTTTGTACGG - Intergenic
941537341 2:166740163-166740185 GGTCTGGTCGGACCTTTGTATGG + Intergenic
942816317 2:180058169-180058191 GGTCTGATCGGGCCTTTGTATGG - Intergenic
942830629 2:180234756-180234778 GGTCTGGTAGGACCTTTGTATGG - Intergenic
943102842 2:183508890-183508912 GATCTGGTCGGACCTTTGTATGG + Intergenic
943134219 2:183891211-183891233 GATCTGGTCGGAACTTTGTATGG - Intergenic
944039501 2:195337868-195337890 GGTCTGGTCGGACTTTTGTATGG + Intergenic
945720113 2:213408597-213408619 GGTCTGGTCGGACCTTTGTACGG - Intronic
947565436 2:231190369-231190391 GCTCTGATCTGTCCTTTGTAAGG + Intergenic
948485144 2:238276005-238276027 GGTCTGGGTGGCCCTTTGTGGGG + Intronic
948485155 2:238276067-238276089 GGTCTGGGTGGCCCTTTGTGGGG + Intronic
948485166 2:238276129-238276151 GGTCTGGGTGGCCCTTTGTGGGG + Intronic
948987833 2:241536179-241536201 GCTCTGGTCTGACCTGTGTTGGG + Intergenic
1168823960 20:796385-796407 GGTCTGGTCAAACCTTTGTATGG - Intergenic
1172340886 20:34156537-34156559 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1173409250 20:42794916-42794938 GGTGTGGTCAGACCTATATAAGG - Intronic
1175513992 20:59557028-59557050 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1176769577 21:13057005-13057027 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1177263747 21:18758496-18758518 GGTCTGGTCGGACCTTTGTGTGG + Intergenic
1177895987 21:26856556-26856578 GGTGTGGTCAGACCTTTGTATGG - Intergenic
1178109540 21:29356586-29356608 GATCTGGTCAGACCTTTGTATGG + Intronic
1179259360 21:39744587-39744609 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1180434474 22:15287142-15287164 GGTCTTGTCAGACCTTTGTATGG - Intergenic
1180516678 22:16150949-16150971 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1181829306 22:25546559-25546581 GGTCTGGTCTGAACTTGGCACGG + Intergenic
1182311811 22:29414659-29414681 GGTCTGGTCAGACCTTTGTATGG + Intronic
1182319845 22:29471569-29471591 GGACTGTTGGGAGCTTTGTAAGG - Intergenic
1182688456 22:32138645-32138667 GGTCTGGTCGGATCTTTGTATGG - Intergenic
1184112805 22:42405190-42405212 GGTCCGGTCCCATCTTTGTAGGG + Intronic
1185004505 22:48267815-48267837 GGGCTGCTCAGAGCTTTGTAGGG + Intergenic
949610166 3:5696104-5696126 GGTCTGGTCGGACCTTTGTATGG + Intergenic
949611363 3:5706989-5707011 GGTCAGGTTGGACCTTTGTATGG + Intergenic
950581110 3:13862670-13862692 TGTCTGGGCGGAGCTTGGTAAGG + Intronic
950594771 3:13970029-13970051 GGACTGGTCAGACCTTTGTATGG + Intronic
951020971 3:17780514-17780536 GGTCTGGTCGGACCTTTGTATGG - Intronic
951200947 3:19874909-19874931 GGTCTGGTCGGACCTTTGTGTGG + Intergenic
951239810 3:20274581-20274603 GATCTGGTCTGAACTTTGTATGG - Intergenic
951708913 3:25570302-25570324 GGTCATGACGGACCTCTGTACGG + Intronic
952554839 3:34520263-34520285 GGTCTGGTGGAACCTTTGTATGG + Intergenic
952922456 3:38295164-38295186 GGTCTTGTCAGATCTTTGTACGG + Intronic
952940483 3:38440538-38440560 GGTCTGTTCAGATCTTTGTGTGG + Intergenic
953260796 3:41337375-41337397 TGTCTGGAAGGACCTGTGTAAGG + Intronic
953622478 3:44545030-44545052 GGTCTGCTCTGAACTTTGTATGG + Intergenic
954096684 3:48334172-48334194 GGTCTGGTTGGACCTTTGCATGG + Intergenic
954599265 3:51855092-51855114 GATCTGGTCTGACCTTTGTATGG - Intergenic
954604558 3:51898760-51898782 GGTCTGGTTGGACCTTTGTATGG - Intronic
955952025 3:64252005-64252027 TGTCTGGTCAGACCTTCCTATGG + Intronic
956842611 3:73154553-73154575 GATCTGGTCAGACCTTTGTATGG + Intergenic
958601567 3:96301545-96301567 GGTCTGGTTGGACCTTTGTTTGG - Intergenic
958630040 3:96672578-96672600 GGTCTGGTTGGGGCTTTGTATGG + Intergenic
960063943 3:113350926-113350948 GGTCTGGTCAGACCCCTGTATGG - Intronic
960659410 3:120041702-120041724 ACTTTGGCCGGACCTTTGTATGG - Intronic
960720521 3:120621059-120621081 GGTCTTGTCGGACCTTTGTATGG + Intergenic
963697206 3:148576597-148576619 GATCTGGTAGGACCTTGGTATGG - Intergenic
963915546 3:150856027-150856049 GGTCTGGTCAGACCTTTGTATGG - Intergenic
963991831 3:151665093-151665115 GGTCTGGTTGGACCTTTGTATGG + Intergenic
964953189 3:162323039-162323061 GGTCTGGTCGGACTTTTGTGTGG - Intergenic
965054962 3:163699845-163699867 GGTCTGCTTGGACCTTCGTGTGG + Intergenic
965139674 3:164817307-164817329 TGTCTGGTCAGATCTTTGTATGG - Intergenic
965277448 3:166703954-166703976 GTTGTGGTCAGACCTATGTATGG + Intergenic
965825000 3:172721303-172721325 GGTCTGCTCAGACCTTTGTATGG - Intergenic
967584133 3:191191622-191191644 TGTCTGGTTGGACTTTTGTATGG - Intergenic
967623348 3:191660480-191660502 GCTCTGGTTGGACCTTTGTATGG - Intergenic
968391346 4:195429-195451 AGTCTGGTCGGACCTTTGTATGG + Intergenic
970092835 4:12429377-12429399 GGTCTGGCTGGACCTTTGTATGG + Intergenic
971578916 4:28308852-28308874 GGTCTGGTCGGACTTTTGTATGG - Intergenic
972651310 4:41020304-41020326 GATCTAGTTGGACCTTTGTATGG - Intronic
972781535 4:42290846-42290868 GGTCTGGTCGGACCTTTGTATGG + Intergenic
972784809 4:42316533-42316555 GATCTGATCAGACCTTTGTATGG - Intergenic
972991479 4:44826723-44826745 GGTCTGCTTGGACCTTTGTATGG + Intergenic
974520232 4:62973322-62973344 GGTCTGGTCGGACCTTTGTATGG - Intergenic
975205505 4:71640183-71640205 GGTCTGGTCAGACCTTTGTATGG - Intergenic
975314084 4:72932045-72932067 GGTCTGGTCCGACCTTTGTATGG + Intergenic
976189595 4:82475680-82475702 GGTCTGGTTGGACCTTTGTATGG - Intergenic
976712067 4:88083333-88083355 GGTCTTGACGGACCTTTTAAAGG - Intergenic
977043721 4:92044241-92044263 GGTCTGGTCGGAACTTTGTATGG + Intergenic
977618182 4:99107982-99108004 GGTCTGGTGGGACCTTCGTATGG + Intergenic
977640642 4:99354714-99354736 GATCTGGTAGGAACTTTGTATGG - Intergenic
977834478 4:101632504-101632526 GATCTGATCAGACCTTTGTATGG + Intronic
977972224 4:103225604-103225626 GGTCTGGTCAGACCTTTGTATGG - Intergenic
978314004 4:107415846-107415868 GGTCTGGTCAGACCTTTGTATGG - Intergenic
978909293 4:114046307-114046329 GGTCTGGTCGGACCTTTGTATGG - Intergenic
980438970 4:132816669-132816691 GGTCTGGTCAGACCTTTGTACGG + Intergenic
980444067 4:132884257-132884279 GGTCTGGTCAGACCTTTGTAAGG - Intergenic
983667171 4:170195118-170195140 GGTCTGGTCGTACCTTTCTATGG + Intergenic
983834471 4:172371260-172371282 TGTCTGGTCGGAACTTCCTATGG + Intronic
987931040 5:24399518-24399540 GATCTGGTTGGACCTTTGTATGG - Intergenic
988358232 5:30203508-30203530 GGTCTGGTCGGACCTTTGTATGG - Intergenic
988457261 5:31397289-31397311 GGTCTGGTCGGACCTTTGTATGG + Intergenic
989096195 5:37783916-37783938 GGTCTGATCAGACCTTTGTATGG + Intergenic
989613761 5:43319372-43319394 GGTCTGGTTGAACCTTTGTATGG + Intergenic
989964159 5:50449489-50449511 GGTCTGGTCGGACCTTTGTATGG + Intergenic
990117056 5:52402297-52402319 GGTCTGGTTGGACCATTGTATGG - Intergenic
990367544 5:55086260-55086282 GATCTGGTCGGACCTTTGTATGG + Intergenic
990892088 5:60660821-60660843 GGTCTGGTTGGACCTTTGTATGG - Intronic
991148130 5:63331589-63331611 GGTTTTGTTGGTCCTTTGTATGG + Intergenic
991305918 5:65175793-65175815 GGTCTGGTCAGACCTTTGTATGG - Intronic
992293746 5:75306333-75306355 GGTCTGGTTGGATCTTTGTATGG - Intergenic
992455652 5:76913260-76913282 GGTCTGATCGGACCTTTGTATGG - Intronic
993055354 5:82974154-82974176 GGTCTGGTTGGACCTTTGTATGG + Intergenic
993658094 5:90597094-90597116 GGACTGGTAGGACATTTGTTTGG + Intronic
995465420 5:112445740-112445762 GGTCTGGTTGGACCTTTGTATGG - Intergenic
995848239 5:116517620-116517642 GTTCTTGTCGGTCCTTTGTCTGG - Intronic
996098902 5:119427900-119427922 GATCTGGTCGGACCTTTGTATGG + Intergenic
996100316 5:119438685-119438707 TGTCTGGTCTGATCTTTGTATGG - Intergenic
996843621 5:127875755-127875777 GGCCTGGTCTGACCTCTGTGTGG + Intergenic
998552715 5:143092991-143093013 GGTCTGCTCGGACCTTTGTATGG + Intronic
998915396 5:147006078-147006100 GATGTGGTCAGACCTTTGTATGG - Intronic
1000236683 5:159368041-159368063 GGTCTGGTTGGACCTTTGTATGG - Intergenic
1001558606 5:172654429-172654451 GGTCTGGTGAGACCTTTGCGTGG + Intronic
1002999271 6:2316210-2316232 GGTCTGGTTGGTCCTTTGTATGG + Intergenic
1003805996 6:9726442-9726464 GATCTTGTCAGACCTTTGTATGG - Intronic
1004007663 6:11652010-11652032 GGACTGGTCAGCCCTTTGTTGGG + Intergenic
1005323894 6:24681027-24681049 GGTCTGGTCGGACCTTTGTATGG + Intronic
1005461782 6:26075907-26075929 GGTCTGGTCAGAGCTTTGTATGG - Intergenic
1008123325 6:47642354-47642376 GGTCTGGTCTGACCTTTGCATGG - Intergenic
1008234928 6:49033609-49033631 GGTCTCCTCAGACCTTTATAAGG - Intergenic
1008582529 6:52919857-52919879 GGTCTGGTTGGACCTTTGTATGG + Intergenic
1009544552 6:65006658-65006680 GCTCTGGTCGGACCTTTGTATGG - Intronic
1009635613 6:66260741-66260763 GGTCTGGTCGGACCTTTGTATGG - Intergenic
1010075277 6:71790646-71790668 GATCTGGTCGGACCTTTGTATGG - Intergenic
1010893269 6:81339051-81339073 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1011076621 6:83445520-83445542 GGTCTGGTCGTACTTTTGTATGG - Intergenic
1011190033 6:84718793-84718815 GGTTTGTTTGGACCTTTGTATGG + Intronic
1011450020 6:87482669-87482691 GGTCTGGTCGGACCTTTATATGG + Intronic
1011540132 6:88419673-88419695 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1011570200 6:88726542-88726564 GGTTTGGTCGGACCTTTGTATGG - Intronic
1012441083 6:99262985-99263007 GATCTGGTTGGACCTTTGTATGG + Intergenic
1013022014 6:106230027-106230049 GGTCTGGTCGGACCTTTGTATGG - Intronic
1013977621 6:116095152-116095174 GGTCTGGTTGGACCTTTGGATGG - Intergenic
1015171804 6:130262509-130262531 GGTCTGGTTGGACCTTTGTATGG - Intronic
1016343414 6:143085856-143085878 GGTCTGGTCGGACCTTTGTATGG + Intronic
1018191551 6:161313758-161313780 GGTCTGGTTGGACCTTTGTATGG + Intergenic
1018687358 6:166314225-166314247 GGTCTGGTTAGACCTTTGTATGG - Intergenic
1018760809 6:166892949-166892971 GATCTGGTCGGACCTTTGTATGG - Intronic
1019165560 6:170095569-170095591 GGTCTGGCCCGACCTTCGGAGGG - Intergenic
1020044033 7:5027000-5027022 GGTCTGGTCAGACCTTTGTATGG + Intronic
1020507945 7:9017787-9017809 GGTCTGGTCGGACTTTTGTGTGG - Intergenic
1021356142 7:19655167-19655189 GGTCTAGTTGGACCTTTGTATGG + Intergenic
1021756276 7:23856164-23856186 GGTCTGGTTGGACCTTTGTATGG + Intergenic
1022489994 7:30809472-30809494 GGTCTGGTCGGGCCTTTGTATGG - Intronic
1023077757 7:36500668-36500690 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1023436513 7:40145945-40145967 GGTCTGGTCAGACCTTTGTACGG + Intronic
1023439507 7:40171455-40171477 GGTCTGGTTGGACCTTTGTATGG + Intronic
1023682038 7:42697000-42697022 GGTCTGGTGGGAGCTTTGAGAGG + Intergenic
1023798928 7:43816187-43816209 GGTCTGGTCAAGGCTTTGTATGG - Intergenic
1025798258 7:64759882-64759904 TATCTGGTAGGACCTTTGTATGG + Intergenic
1028333813 7:89626895-89626917 GGTCTGGTCGGAACTTTGTATGG - Intergenic
1028588839 7:92476093-92476115 GGTCTGGTCGGACCTTTGTATGG + Intronic
1030337069 7:108339173-108339195 GGTCTGGTCAGACCTTTGTATGG - Intronic
1030843751 7:114384585-114384607 GGTCTGGTCGGACCTTTGTGTGG + Intronic
1031471259 7:122172062-122172084 GGTCTGGTCGGACCTTTGCATGG - Intergenic
1031732238 7:125313833-125313855 GATCTGGTTTGACCTTTGTATGG - Intergenic
1032426284 7:131824688-131824710 GGTCTGGTTGGACCTTTGTATGG + Intergenic
1032725599 7:134587677-134587699 GGTCTCATTGGACCTTTGTATGG - Intergenic
1033097760 7:138445754-138445776 GGTCTGGTCGAACCTTTGTATGG + Intergenic
1034249031 7:149673548-149673570 GTTCCGGTTGGACCTTTGTATGG - Intergenic
1034500183 7:151445694-151445716 GGTGTGGTTGGAATTTTGTAGGG - Intergenic
1034579441 7:152029809-152029831 GATCTGGTCGGACCTTTGTATGG + Intronic
1037570826 8:20156406-20156428 AGTCTGGTCAGACCTTCGTATGG - Intronic
1038089512 8:24237472-24237494 GGTCTGATTGGACCTATGTATGG - Intergenic
1039876973 8:41595228-41595250 GGTCTGGTTGGACCTTTGTATGG + Intronic
1041226949 8:55709882-55709904 GGTCTGGTCAGACCTTTGTATGG - Intronic
1042055935 8:64764915-64764937 GGTCTGGTCGGAACTTTGTGTGG - Intronic
1042088089 8:65130648-65130670 GGTCTGGTCGGACCTCTGTATGG + Intergenic
1044184822 8:89238975-89238997 GGTCTGGTTGGACCTTTATATGG + Intergenic
1047444118 8:124904472-124904494 GGTTTGGTTGGACCTTTGTATGG + Intergenic
1049877491 8:145034732-145034754 GGTATGTTCAGACCTTTGTATGG - Intergenic
1050480617 9:6083698-6083720 AGTCTGGTCGAACTTTTGTATGG - Intergenic
1052289960 9:26829276-26829298 GATCTGGTTGGACCTTTGTGTGG - Intergenic
1052302705 9:26972073-26972095 AGTCTGGCCAGACCTTTGTATGG + Intronic
1052507931 9:29379069-29379091 GGTCTGGTAGGACCTTTGTATGG - Intergenic
1052529151 9:29658460-29658482 GGTCTGGTAGGACCTTTGTATGG + Intergenic
1052538672 9:29778889-29778911 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1053110961 9:35459811-35459833 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1053705644 9:40750351-40750373 GGTCTGGTCAGACTTTTGTATGG + Intergenic
1054415721 9:64873958-64873980 GGTCTGGTCAGACTTTTGTATGG + Intergenic
1056414618 9:86364465-86364487 GGTCTGGTCGAACCTTTGTATGG + Intergenic
1056704780 9:88942679-88942701 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1186254272 X:7702082-7702104 GGTCTGGTCAGACCTTTATATGG + Intergenic
1188097984 X:26046077-26046099 GGTCTGGTTGGACCTTTGTATGG - Intergenic
1188136961 X:26503316-26503338 GGTCTGGTTGGACCTTTGTATGG - Intergenic
1189034396 X:37480715-37480737 GGTCTGGTCGGACCTTTGTATGG - Intronic
1190270067 X:48855652-48855674 GGTCTGATCAGACCTTTGTATGG - Intergenic
1190771071 X:53514616-53514638 GGTCTGGTCGGACCTTTGTATGG - Intergenic
1191167246 X:57403802-57403824 GGTCTGTTCAGACATTTGTATGG + Intronic
1191890079 X:65930932-65930954 GGTCTGGTCGAACCTTTGGATGG + Intergenic
1191918124 X:66224392-66224414 GGTCTGGTTGGAACTTTGTATGG + Intronic
1192482316 X:71496215-71496237 GATCTGGTCGGACCTTTGTGTGG + Intronic
1192940128 X:75903154-75903176 GGTCTGGTCAGACCTTTGTATGG + Intergenic
1193306485 X:79957797-79957819 GGTCTGGTCGGACCTTTGTATGG - Intergenic
1193717186 X:84946635-84946657 GGTCTGGTCGGACCTTTGTATGG - Intergenic
1195847075 X:109240331-109240353 GGTCTGGATGGACCTTTGTATGG + Intergenic
1195850721 X:109279130-109279152 GGTCTCATCAGACCTTTGTATGG + Intergenic
1196126923 X:112110880-112110902 GATCTGGTTGTACCTTTGTATGG + Intergenic
1196460236 X:115922276-115922298 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1197905661 X:131422579-131422601 GGTCTGGTGGGACCTCTGCTTGG - Intergenic
1198742303 X:139853992-139854014 GGTCTGGTCAGACCTTTGTGTGG - Intronic
1199637606 X:149828180-149828202 GGTATGGTCAGACCTTTGTATGG - Intergenic
1199941894 X:152636023-152636045 GGTCTGGTCGCTCATTTGTTAGG - Intergenic
1200694682 Y:6348472-6348494 GGTCTTGTTGGACCTTTGTATGG + Intergenic
1200711572 Y:6489415-6489437 GGTCTGGTTGGACTTTTGTATGG - Intergenic
1200763442 Y:7060931-7060953 GGTCTGGTTGGACCTTTCTATGG + Intronic
1200851754 Y:7890523-7890545 GATGTGGTCGGATCTTTGTAAGG + Intergenic
1200880412 Y:8206647-8206669 GATCTGGTTGGACATTTTTATGG + Intergenic
1200945508 Y:8831445-8831467 GGTCTGCTCAGACCTTTGTATGG - Intergenic
1201022362 Y:9672564-9672586 GGTCTGGTTGGACTTTTGTATGG + Intergenic
1201040595 Y:9826238-9826260 GGTCTTGTTGGACCTTTGTATGG - Intergenic
1201271764 Y:12262602-12262624 GGTCTGGTCGGACCTTTGTATGG + Intergenic
1201297321 Y:12475008-12475030 GGTCTGGTCAGACCTTTATATGG + Intergenic
1201308146 Y:12568950-12568972 GGTCTGTTTGGACCCTTTTATGG - Intergenic
1201648575 Y:16261962-16261984 GGCCTGGTCAGACCTTTGTATGG + Intergenic
1201654235 Y:16323339-16323361 GGCCTGGTCAGACCTTTGTATGG - Intergenic
1201900065 Y:19039994-19040016 GGTATGGTCCGACCTTTGTGTGG + Intergenic
1201905446 Y:19081951-19081973 GGTGTGGTCGGACTTTTGTATGG - Intergenic
1201919698 Y:19221105-19221127 GGTCTGGTCAGACCTTTGTATGG - Intergenic
1202089691 Y:21176910-21176932 GGTCTAGTCAGACCTTTGTATGG + Intergenic
1202192210 Y:22257158-22257180 GGTCTGATCAGACCTTTGTATGG + Intergenic