ID: 988358236

View in Genome Browser
Species Human (GRCh38)
Location 5:30203528-30203550
Sequence ACCTAGGAGAAACTCCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988358232_988358236 -3 Left 988358232 5:30203508-30203530 CCATACAAAGGTCCGACCAGACC 0: 41
1: 115
2: 101
3: 52
4: 54
Right 988358236 5:30203528-30203550 ACCTAGGAGAAACTCCCTTCAGG No data
988358230_988358236 28 Left 988358230 5:30203477-30203499 CCTAACAGGGGATCTAAATCTTA 0: 100
1: 103
2: 66
3: 42
4: 112
Right 988358236 5:30203528-30203550 ACCTAGGAGAAACTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988358236 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG Intergenic
No off target data available for this crispr