ID: 988361285

View in Genome Browser
Species Human (GRCh38)
Location 5:30239655-30239677
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 11, 1: 123, 2: 153, 3: 137, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988361285_988361290 0 Left 988361285 5:30239655-30239677 CCCTACCCTTCACCTATTTTACA 0: 11
1: 123
2: 153
3: 137
4: 371
Right 988361290 5:30239678-30239700 TATACCTACCCTTCCCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988361285 Original CRISPR TGTAAAATAGGTGAAGGGTA GGG (reversed) Intergenic
900437302 1:2637237-2637259 TGTAAAATAGGTGAAGGGTGGGG + Intronic
901000378 1:6146125-6146147 TGTAAAATGGGTGCAGCGCAGGG - Intronic
901676221 1:10887353-10887375 TTTAAATTAGGTGAACTGTATGG + Intergenic
901895430 1:12307830-12307852 TATAAAATAAGTGAATGTTATGG + Intronic
903207786 1:21795812-21795834 TGTGAAATAGGTGAAGGGTACGG + Intergenic
904344900 1:29861386-29861408 TGTAAAATAGATGAAGGGTGGGG + Intergenic
904449369 1:30601114-30601136 TGTAAAACAGGTGAAGGGTGGGG - Intergenic
904518095 1:31072466-31072488 TGTAAAACAGGTGAAGGGTGGGG + Intergenic
904996343 1:34634589-34634611 GGTAAAATGGGGGAATGGTAAGG + Intergenic
905060380 1:35134964-35134986 GGTAAAATAGGGGAATTGTAAGG + Intergenic
905804157 1:40863811-40863833 TGTCAAATGCGTGGAGGGTAAGG - Intergenic
905927438 1:41762006-41762028 TGTAAAATAGGTGAGGAGTGGGG - Intronic
906081054 1:43088581-43088603 GGTAAAATGGGGGAATGGTAAGG - Intergenic
906876016 1:49540214-49540236 TGTAACATAGGTAAAGTTTATGG - Intronic
907165948 1:52411374-52411396 GATAAAATATTTGAAGGGTAGGG + Intronic
909926170 1:81440130-81440152 TGTAAAATAGGTGAAGGGTGAGG + Intronic
909978304 1:82070153-82070175 GGTAAAATAGGGGAATTGTAAGG + Intergenic
910036053 1:82790591-82790613 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
910069930 1:83200758-83200780 TGTAAAATACGTGAAGGATGGGG - Intergenic
911162162 1:94692006-94692028 CGTAAAATAGGTGAAGGGTGGGG + Intergenic
911608554 1:99935915-99935937 TGTAAAGTAGGTGAAGCTTGGGG - Intergenic
911610474 1:99954744-99954766 TGTAAAATAGGTAAAGGGTGGGG - Intergenic
911893233 1:103398967-103398989 CATAAAATAGGTGGAAGGTAAGG - Intergenic
912098840 1:106180959-106180981 TATAAAATAGGTGAACAGTGGGG - Intergenic
912407456 1:109452573-109452595 TGTAAAATAGGTGAAGAGTGGGG + Intergenic
912597488 1:110893770-110893792 GGTAAAAAAGGTGAAGGAGAAGG + Intronic
915163571 1:153935788-153935810 TGTAAAATGTGTGATGCGTATGG + Intronic
915498936 1:156301154-156301176 TGTAAAATAGGTGACGCGTGGGG - Intergenic
915647398 1:157283260-157283282 TGTAAAAATGGTGAAGGTGAAGG + Intergenic
915691672 1:157696682-157696704 TGAAGAATAGGAGAAGGGTTTGG - Intronic
916048591 1:161019236-161019258 AGTAAAATAGGCAAGGGGTAGGG + Intronic
916146185 1:161741847-161741869 TGGAAAAGAGGTGAAACGTAAGG - Intergenic
916329002 1:163594091-163594113 GGTAAAATAGGGGAATTGTAAGG - Intergenic
916629677 1:166598828-166598850 TGTATAATAGGTGAAGGATGGGG - Intergenic
917072619 1:171169045-171169067 TATAAAATAGGTGAAGGGTAGGG - Intergenic
917371906 1:174301843-174301865 TGTAAAATAGGCGAAGGCTGGGG + Intronic
917954912 1:180085134-180085156 TGTGAAATAAGGGAAGGGAAGGG - Intronic
918258483 1:182771950-182771972 TGTCAAATAGGTGATCGGGATGG + Intergenic
918777059 1:188646534-188646556 TGTAAAATAGGTGCAGGGATAGG + Intergenic
918902409 1:190441076-190441098 TGTAAAATACTTGAATGTTATGG + Intronic
919004143 1:191872450-191872472 TGTAAAATAGATGAAGGATGGGG + Intergenic
919217141 1:194571813-194571835 TGTAAAATAGGTTAAAGGCAGGG + Intergenic
920637118 1:207714347-207714369 TGTGAAATAGATGAAGAGTGGGG + Intronic
920829548 1:209451995-209452017 GGTAAAATGGGGGAATGGTAAGG - Intergenic
920901387 1:210113449-210113471 GGTAAAATGGGTGAATTGTAAGG + Intronic
921014413 1:211175335-211175357 TGTAAAATAGTTGAAGAATGGGG - Intergenic
922048550 1:221969019-221969041 GGTAAAATGGGGGAATGGTAAGG - Intergenic
922334103 1:224605115-224605137 TGTAAAATAGGTGAAGGGTGGGG + Intronic
922363393 1:224843091-224843113 TGTAAAATAGGGGAATTGTATGG + Intergenic
922877228 1:228949310-228949332 GGTAAAATAGGGGAATGGTAAGG - Intergenic
923088530 1:230720638-230720660 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
923726474 1:236510039-236510061 TGTAAAACAGGTGAAAGATAAGG + Intergenic
923770596 1:236934898-236934920 GGTAAAATGGGGGAATGGTAAGG + Intergenic
924044574 1:240013891-240013913 TGCAAGATAGGTGAAGGGATTGG - Intergenic
924896034 1:248338862-248338884 GGTAAAATGGGGGAATGGTAAGG + Intergenic
924928605 1:248707287-248707309 TATACAATGGGTGAAGGGGAGGG - Intergenic
1063815862 10:9770485-9770507 TGTAAATAAGGGGAAGCGTAGGG - Intergenic
1064520501 10:16195951-16195973 GGTAAAATAGGTTATGGGAAGGG + Intergenic
1065218310 10:23471935-23471957 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1065272090 10:24044560-24044582 TGGAAAAGAGGTGAAAGGAAGGG - Intronic
1065896679 10:30168924-30168946 GTTAAAATAGGTGAAGCATAAGG - Intergenic
1066490346 10:35888230-35888252 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1067120980 10:43471905-43471927 TATAAAATAGGTGAAGAGTGGGG + Intronic
1069142137 10:64839943-64839965 TGCAAAATAGGTGAAAGGTGGGG - Intergenic
1069156620 10:65037762-65037784 TGCAAAATAGATGAAGGATGGGG - Intergenic
1069431066 10:68334436-68334458 TTTAAAATTGGTGAAGTTTACGG - Intronic
1069576098 10:69529395-69529417 TTTTAAATAGGTGAATTGTATGG + Intergenic
1070420622 10:76232983-76233005 TGTAAAATAGGTGAAAGGTGGGG + Intronic
1071866525 10:89740568-89740590 TTTGAAATAGCTTAAGGGTAGGG - Intronic
1071916345 10:90298072-90298094 AGTAAAATGGGGGAATGGTAAGG - Intergenic
1072181280 10:92983428-92983450 TTTAAAAAAGGGGAAGGGAAAGG - Intronic
1072199312 10:93144446-93144468 TGTGAAATAGATGAAGGGTAGGG - Intergenic
1072598518 10:96899942-96899964 CTTAAAATAGGTGAATTGTAAGG - Intronic
1073044236 10:100627111-100627133 TGTTAAATAGGTGAATTGTATGG + Intergenic
1073640006 10:105241911-105241933 TGTAAAGTAGGTGAAGAATAGGG + Intronic
1073671394 10:105594154-105594176 TGATAAAAAGGTGAAGGGCAGGG - Intergenic
1073902812 10:108243811-108243833 TTTAAAATAGGTAAAGGATGGGG - Intergenic
1073931733 10:108584619-108584641 TGCAAAATAGGTGAAGGGTAGGG - Intergenic
1074215754 10:111382027-111382049 TGTAAAATAGGTGAAGGATGGGG + Intergenic
1074745600 10:116529008-116529030 TGTAAAATAGATGAAGGGTGGGG - Intergenic
1074990753 10:118704583-118704605 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1075248844 10:120847917-120847939 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1075264495 10:120989165-120989187 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1075265338 10:120996194-120996216 CGTAAAATAGGTGAAGGGTGGGG - Intergenic
1075570050 10:123534985-123535007 TGTAAAACAGGTGGAAGATAAGG + Intergenic
1075995019 10:126870090-126870112 TGGAAAGTGGGTGAAGGGTTTGG + Intergenic
1077013757 11:391123-391145 TGGAAAGTAGCTGAGGGGTATGG - Intergenic
1077766241 11:5162918-5162940 GGTAAAATGGGGGAATGGTAAGG + Intronic
1078047180 11:7926006-7926028 TGTAAAATAGGTGAAGAGCGGGG - Intergenic
1079646168 11:22866107-22866129 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
1080125513 11:28729199-28729221 TGTAAAATAGGTGAAGGGTGAGG - Intergenic
1080445741 11:32335355-32335377 TGTAAAATAAGTGAAGGGTGGGG + Intergenic
1081153662 11:39663498-39663520 TGTAAAACAGGTGAAGGGTGGGG - Intergenic
1081155098 11:39680422-39680444 TGTAAAATAGGTGAAGGGTGTGG + Intergenic
1081641554 11:44759012-44759034 TATAAAATCGGTAAAGGGTCAGG - Intronic
1081650905 11:44823568-44823590 TGTAGAATAGGTTAAGGGTGGGG + Intronic
1082090079 11:48081755-48081777 TGTAAAATGGGTGGGGGGAAGGG + Intronic
1082663793 11:55949105-55949127 TGTAAAATAGGTGAAGTATGGGG - Intergenic
1084784031 11:71431244-71431266 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1084875052 11:72124907-72124929 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1085152228 11:74261372-74261394 TGTAAAATAGGTGAAAGGTGGGG + Intronic
1085370155 11:75995284-75995306 AGTAAAATAGGAGAAAAGTATGG - Intronic
1086343850 11:85875236-85875258 TGTAAAATAGGTGAAGGATGAGG + Intronic
1086469026 11:87086718-87086740 TGTAAAATAGGTGGAGGGTGGGG + Intronic
1086665928 11:89482114-89482136 TTTAAAATAGTTGTAGGGTAGGG + Intronic
1086818737 11:91406955-91406977 TATAAAATAGGTGAAGGGTGGGG + Intergenic
1087099229 11:94348793-94348815 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1087197052 11:95312591-95312613 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1087296506 11:96381864-96381886 TGTAAAAGCAGTGATGGGTAAGG + Intronic
1087886770 11:103491260-103491282 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1088092877 11:106063960-106063982 TGTAAAATAAGTGGAAGTTAAGG + Intronic
1088095259 11:106092426-106092448 TGTCAGATAGGTGAATGGAATGG + Intronic
1088728453 11:112659682-112659704 AGAAAAATAGGTGAAGGGTGGGG + Intergenic
1088888240 11:114024455-114024477 TGTAGAATGGGGGAAGGGAAGGG - Intergenic
1089374289 11:117983577-117983599 TGTAAAGTAGGTGAAGGGTGGGG - Intergenic
1090150058 11:124374510-124374532 TGTAAAATAGGTGAAGTGTGGGG + Intergenic
1090293548 11:125567198-125567220 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1090548932 11:127797611-127797633 TGTAAAATAGGTGAAAGGTAAGG - Intergenic
1090850452 11:130566998-130567020 GGTAAAATGGGGGAACGGTAAGG + Intergenic
1090926797 11:131257128-131257150 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1091861625 12:3790421-3790443 TGCAGAATAGGTGCAGGGTGGGG + Intergenic
1092049630 12:5458931-5458953 TATAAAATAGAAGAAGGGTTTGG - Intronic
1092491949 12:8953435-8953457 TATAAAATGGGTGAAAGGTGGGG + Intronic
1092698604 12:11201950-11201972 TGTAAAACAGGTGAAAGGTGAGG - Intergenic
1092795676 12:12108208-12108230 TGTAAAATAGGTTAAGGGTAGGG + Intronic
1093465804 12:19447613-19447635 TGTAAAATAGGAGCAGTGTTAGG + Intronic
1093684316 12:22039100-22039122 TATAAAAGAGGTGGAGGGCATGG - Intergenic
1093705737 12:22273258-22273280 TGAAAAATAGGTGAACGGTGGGG - Intronic
1093758761 12:22881555-22881577 TGTAAGATAGGTGAAGGGTGGGG + Intergenic
1093934582 12:24987230-24987252 TGTTAATAAGGTCAAGGGTATGG - Intergenic
1095307140 12:40651683-40651705 TGTAAAATAGGTGAAGGCTGGGG + Intergenic
1095426407 12:42079071-42079093 TGAAAAATAGGTGCTTGGTATGG + Intergenic
1096282028 12:50264339-50264361 TTTTAAATAGGTGAATTGTATGG + Intronic
1097006785 12:55925336-55925358 AGTGAAATAGGTGACTGGTAAGG + Intronic
1097465612 12:59920944-59920966 TCTAAAATAGGTGAAAGCTAAGG - Intergenic
1098488682 12:71050299-71050321 TGTAAAATAAGTGAAGGGTAGGG - Intronic
1098589671 12:72195897-72195919 TGTATATAAGGTGAAAGGTATGG + Intronic
1098702470 12:73646049-73646071 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1098991291 12:77066885-77066907 TGTAAAGTAGATGGGGGGTAGGG - Intergenic
1099534089 12:83824243-83824265 TGTAAACCAGGTGAAAGGTGAGG + Intergenic
1099938203 12:89153286-89153308 TTTAAAATAGGTGAAAGGTGGGG + Intergenic
1100072551 12:90737844-90737866 TGTCAAATCTGTCAAGGGTAGGG - Intergenic
1100263487 12:92954294-92954316 TGTAAAATAGGTGAAGAGTGGGG + Intergenic
1100940494 12:99718573-99718595 GGTAAAATAGGGGAATTGTAAGG - Intronic
1101961032 12:109250265-109250287 TCTAAAACAGGTGCAGGGGATGG - Intronic
1102311957 12:111852291-111852313 GGTAGAAGAGGTGAAGGGCATGG - Intronic
1102663455 12:114549403-114549425 TGTAAAGTAAGTGAAGGGTGGGG + Intergenic
1104144155 12:126016973-126016995 TGTAAAATAGGTAAAGGGTGGGG - Intergenic
1104207267 12:126651257-126651279 TATAACATACGTGAAGGGTCTGG - Intergenic
1104307445 12:127622157-127622179 TGTGAAATAGGTGAAGGGTGGGG + Intergenic
1105915948 13:24915909-24915931 TGTGAAACAGATGAAGGGTAAGG + Intronic
1106629125 13:31452224-31452246 TGTAAAATAGGTGAAGGATGGGG - Intergenic
1106660607 13:31795678-31795700 TGTAAGATTGGTGAAGTCTAGGG - Intronic
1106789058 13:33136513-33136535 TGTAAAATAGAGGAAGGGTGAGG - Intronic
1106798624 13:33233245-33233267 TGTAAAATAGATGAAGGGTGGGG - Intronic
1106933943 13:34697302-34697324 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1106943587 13:34801712-34801734 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1107356301 13:39571310-39571332 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1107620564 13:42224786-42224808 AGTTAACCAGGTGAAGGGTAGGG - Intronic
1107823238 13:44305071-44305093 TGTAAAATAGGTGAAGTGCGAGG + Intergenic
1108197453 13:48009279-48009301 TGGAAATTAGGTGAAAGGTGAGG + Intergenic
1108810214 13:54213897-54213919 TGTAAAATAGGTAAAGGATAAGG - Intergenic
1108826351 13:54416671-54416693 TGTAAAATAGGTGGAGGATGAGG + Intergenic
1109116815 13:58398688-58398710 TGTAAAATAGGTGAAGTATGGGG + Intergenic
1109123533 13:58488642-58488664 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1109136446 13:58656995-58657017 TGTAAAACAGGTGAAGGGTGGGG + Intergenic
1109213780 13:59564518-59564540 TGAAAAAGAGATGAAGAGTATGG + Intergenic
1109510689 13:63368103-63368125 TGTAAAATAGGTGAAGAGTGGGG + Intergenic
1109527531 13:63596331-63596353 AGTAAAATAGGTAAAGGGTAGGG + Intergenic
1109821916 13:67668288-67668310 TGTCAAATAGGTGAAGGATAAGG - Intergenic
1109833787 13:67828381-67828403 TGTTAAATAGGTTAAGGGACAGG + Intergenic
1109892198 13:68630178-68630200 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1109923043 13:69094344-69094366 TGTGAAAGAAGTTAAGGGTAGGG + Intergenic
1110107238 13:71692815-71692837 TTTAAAATAGGTGAACGGGCTGG - Intronic
1111028586 13:82567484-82567506 TGTAAAATAGGTAAAGGATGAGG + Intergenic
1111028962 13:82570644-82570666 TGTACAGTAAGTGAAGGGTAAGG + Intergenic
1111047228 13:82829584-82829606 TGTAAAATAGGTGAAGGGTGAGG + Intergenic
1111097889 13:83538645-83538667 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1111125897 13:83910917-83910939 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1111213349 13:85109211-85109233 GGTAAAATTGGTGAAAGGTGGGG + Intergenic
1111244656 13:85520119-85520141 TGAAAAATAGGTCAAGACTAAGG + Intergenic
1111254295 13:85645387-85645409 TGTAAAATAGGTGAAAGGTGGGG + Intergenic
1111278831 13:85990755-85990777 TTTAAACTAGGTGAAGTGTGGGG + Intergenic
1111310017 13:86472206-86472228 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1111361963 13:87189056-87189078 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1111423811 13:88052703-88052725 TGTAAAATAGGTGAAGTGTGGGG + Intergenic
1112260339 13:97872420-97872442 TGTTGAATAGGTGAAGTGTGTGG + Intergenic
1114739257 14:25078352-25078374 TGTAAAAAAGGGGAAAGGCAGGG - Intergenic
1116003946 14:39272394-39272416 TGTAAAATAGGTGAAAGATGGGG + Intronic
1116116159 14:40653714-40653736 TGTTAAATAGATGAAGCATATGG + Intergenic
1116296220 14:43113749-43113771 TGTGAAATAGGTGAAAGGTAAGG + Intergenic
1116307579 14:43277760-43277782 TATAAAATGGGTGAAAGGTAAGG + Intergenic
1116335062 14:43647328-43647350 TGTAAAATAGATGAACAGTGGGG - Intergenic
1116380519 14:44262017-44262039 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1116566308 14:46448834-46448856 TGTAAAAGAGGCGAAGGGTGGGG - Intergenic
1117084715 14:52187817-52187839 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1117928549 14:60812594-60812616 CATAAAATAGGTGAAGAGTGGGG - Intronic
1118240077 14:64047391-64047413 TGTAAAATAGGGGAAGGGTGGGG + Intronic
1118440687 14:65808872-65808894 TGTAAAATAGTTGAAGGGTGGGG + Intergenic
1118648012 14:67858614-67858636 CGTAAAATAGGTGAAGGGTGAGG + Intronic
1118973712 14:70659273-70659295 GGGAAAATGGGTAAAGGGTATGG + Intronic
1120460791 14:84792633-84792655 TGTAAAATAGGTGAACGGTGGGG - Intergenic
1120654959 14:87178529-87178551 AATAAAATAGTTGAAGGGGAAGG - Intergenic
1120804887 14:88736783-88736805 TGTAAAGTAAGTGAAAGGTGGGG - Intronic
1120942146 14:89958637-89958659 TGTAAAGTAGGTGAAGGGTGGGG + Intronic
1121594075 14:95146296-95146318 TGTAAGATAGGTGAAGGGTGAGG - Intronic
1123826449 15:24086870-24086892 TGTAAAGTAGGTGAAGGGTGGGG + Intergenic
1124054399 15:26228464-26228486 TGTAAAATAGGTGAAGGATGAGG + Intergenic
1124096165 15:26650653-26650675 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1124821706 15:33052791-33052813 TATAAAATAGGGGAAGGGTGGGG - Intronic
1125129996 15:36273078-36273100 TTTAAAATAGATGAAGGAAAGGG - Intergenic
1125733247 15:41906189-41906211 TGTAAAATAGGTGAAGGGTGAGG - Intronic
1126088392 15:45030030-45030052 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1126225732 15:46267030-46267052 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1126883024 15:53119456-53119478 TGAAAGATAGGTGATGGTTAGGG - Intergenic
1126912269 15:53429474-53429496 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1126984139 15:54283049-54283071 TATAAAATAGATGAAGGGTGGGG + Intronic
1128466762 15:67919012-67919034 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1128560633 15:68664835-68664857 TAAAAAATAGGTGAAGAATATGG - Intronic
1129340542 15:74882996-74883018 TGTAAAATAGGTGAGGGGTGGGG + Intergenic
1129806254 15:78461368-78461390 GGGAAAAGGGGTGAAGGGTAAGG - Intronic
1130142508 15:81240273-81240295 TTTAAAGTAGGTGAGGGGAAAGG - Intronic
1130427045 15:83811851-83811873 TGTAAAATAAGGGAAGGTTGTGG + Intronic
1131165015 15:90135904-90135926 GGTAAAATAGGGGAATTGTAAGG - Intergenic
1131192563 15:90328751-90328773 TGTAATATGGGAAAAGGGTAAGG - Intergenic
1131663616 15:94545713-94545735 ATTAAAATGGGTGAAGAGTATGG + Intergenic
1131692318 15:94840872-94840894 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1131786474 15:95917793-95917815 TGTAAAATATGTTTATGGTAAGG + Intergenic
1133005591 16:2879847-2879869 TGTAAAATAGGTGAAATGTGGGG - Intergenic
1134123451 16:11600580-11600602 TGTCAAATAGGTGAAGGGTGGGG - Intronic
1135926776 16:26701826-26701848 TGTAAAATAGGTGAAGGTTGGGG - Intergenic
1136062968 16:27739304-27739326 TTTAAGATAGGTGAAGACTAGGG + Intronic
1137011158 16:35321757-35321779 TATAGAAAAGGTGAAGGGTATGG - Intergenic
1137772221 16:51025512-51025534 AGTAAAACTGGTGAGGGGTAAGG + Intergenic
1137976081 16:53033330-53033352 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1138152369 16:54670458-54670480 TGTTAAATAGGTAAGGGGTGGGG + Intergenic
1138304258 16:55959815-55959837 TTTAAAATTGGTGAAGAGTTGGG + Intergenic
1138526085 16:57608060-57608082 TGTAAAATAGGTATATGGTCAGG + Intergenic
1138710959 16:58969975-58969997 TGTAAAATAAGTGAAGGGTGGGG + Intergenic
1138743379 16:59335748-59335770 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1138758953 16:59520272-59520294 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1139039094 16:62981780-62981802 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1139230446 16:65277887-65277909 GGTAAAATGGGGGAATGGTAGGG + Intergenic
1139291690 16:65864273-65864295 TGTAAAATAGGTGAAGGGTGAGG - Intergenic
1139329235 16:66174769-66174791 TGTAAAACAGGTGAAGGATGGGG - Intergenic
1139739813 16:69025545-69025567 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1140248716 16:73275245-73275267 TGTAAAATAGAGGAAGAGAAAGG - Intergenic
1140256573 16:73342044-73342066 TGTAAAATGGGTGAATTGTATGG + Intergenic
1140703104 16:77601090-77601112 CGTAAAATAGGTAAAGGGTGGGG - Intergenic
1140727544 16:77827529-77827551 TGTAAAACAGGTGAAGGAACTGG + Intronic
1140792762 16:78408213-78408235 TGTAAAATAGGTGAAAGGTGGGG - Intronic
1140950040 16:79808330-79808352 TATGAAATAGGTGAATGGCAGGG - Intergenic
1141796681 16:86279613-86279635 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1141862328 16:86726373-86726395 TGTAAAAGAGGTTTAGGGTTTGG - Intergenic
1143706811 17:8703773-8703795 TGTAAAATAGGTGAAAGGTGGGG + Intergenic
1143888376 17:10083868-10083890 CATAAAATAGGTGAAGGGTAGGG + Intronic
1145223042 17:21104905-21104927 TGTAAAATAGGTGAAGAGTGGGG - Intergenic
1145717812 17:27039453-27039475 TGAAAAATAGGCAAAGGATATGG - Intergenic
1146133371 17:30297264-30297286 TGTAAATTAGGTGAAGGATGGGG - Intergenic
1146419559 17:32670639-32670661 TGTAAAATAGGTGAAAGGTGGGG - Intronic
1146598048 17:34186354-34186376 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1146837753 17:36125918-36125940 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1147224748 17:38967801-38967823 TCAAAACTAGGTGAAGGGAAAGG - Intergenic
1147231379 17:39021209-39021231 TGTAAAATAGGTTAAAGGCAGGG - Intergenic
1148627062 17:49077725-49077747 TGTAAAACTGGTGAAGTGTGGGG - Intergenic
1149289547 17:55203450-55203472 TGTAGAATGGGTGGATGGTAGGG + Intergenic
1149644262 17:58228316-58228338 TGTGAAATAGGTGAAGGATGGGG + Intronic
1149980585 17:61308211-61308233 TGTAAACTAGCTGAAGGCTTGGG - Intronic
1150726862 17:67658293-67658315 TTTAAAATAGGTGAAGGGTGGGG - Intronic
1150737146 17:67750791-67750813 TGTAAAACAGGTGCAGGGTGGGG - Intergenic
1151635853 17:75347350-75347372 TGTAAAATAGGTGAAGAGTGGGG - Intronic
1153210513 18:2758413-2758435 TGTAAATTGGGAGAAGGGAATGG - Intronic
1153361218 18:4199050-4199072 AGTAGAGTAGGTGAGGGGTAGGG - Intronic
1153394770 18:4606349-4606371 TGGATGATAGCTGAAGGGTATGG + Intergenic
1153502880 18:5767088-5767110 AGTAATATAGGTGAAGGGTGTGG - Intergenic
1153821684 18:8837490-8837512 TGTAAAATAGGTGAAAGGTGGGG + Intergenic
1155310489 18:24518290-24518312 TGTAAAACAGGTGAAGGGTGGGG + Intergenic
1155461315 18:26087383-26087405 ATTAAAATAGGTGAATTGTATGG + Intronic
1155819818 18:30361618-30361640 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1156445235 18:37231750-37231772 TGCAGAACAGGTGAAGGGCACGG - Intronic
1156475383 18:37402548-37402570 TGGAAAGTAGGTGTGGGGTAGGG + Intronic
1156645365 18:39155667-39155689 TGTAAAATATGTGAAGGGTGGGG - Intergenic
1156783622 18:40882233-40882255 TGTAAAATAGGTGAACGGTGGGG - Intergenic
1156985247 18:43343056-43343078 TGTGACATGGGGGAAGGGTATGG + Intergenic
1156993680 18:43440331-43440353 TGTAAAATAGGTGAAGAGTGGGG - Intergenic
1157649343 18:49312349-49312371 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1158018376 18:52810732-52810754 TTTGAAACAGGTGAAGGGTAGGG + Intronic
1159076300 18:63685312-63685334 TGTAAAATAGGTTAAGGGTGGGG + Intronic
1159202558 18:65206357-65206379 TGTAAAATAGGTGAAGAGTGAGG - Intergenic
1159308655 18:66679058-66679080 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1159431173 18:68355947-68355969 TGTAAAATAGATGAAAGGTGAGG - Intergenic
1159431860 18:68362689-68362711 TGTAAAATAGGTGAAGAGTAGGG - Intergenic
1161113569 19:2483890-2483912 TGTTAACTAGGAGAAAGGTAGGG - Intergenic
1162466311 19:10843209-10843231 TGCAAACTAGGTGGAGGGTGGGG + Intronic
1162878753 19:13641018-13641040 AGTAAAATAGGTCAAAGGAAAGG - Intergenic
1164059968 19:21662750-21662772 TGTAGAATATTTGAAAGGTATGG + Intergenic
1165638516 19:37364186-37364208 CGTAAAATAGGTGAAGGGTTGGG - Exonic
1165872064 19:38980140-38980162 TGTAAAATAGATGAAGGGTGGGG - Intergenic
1167104300 19:47421227-47421249 TGTAAAACAGGTGCAGGACAGGG - Intergenic
1167179557 19:47892250-47892272 TGTAAAATAGGTGAAAGGTAAGG - Intergenic
1168170620 19:54586238-54586260 TGTCAAATATGTGAAGCATATGG - Intronic
1168634396 19:57984303-57984325 TGTAAAATGGGAGAAGTGTAAGG + Intronic
925760947 2:7183893-7183915 TGGAAAATAGATGAAGGAAAAGG + Intergenic
925896212 2:8474217-8474239 TGTAACACAGGTGAGGGGTTAGG - Intergenic
926017211 2:9464180-9464202 TGTAAAATAGAAGAATGTTATGG - Intronic
926463946 2:13166627-13166649 GGTAAAATGGGGGAATGGTAAGG + Intergenic
926473053 2:13285276-13285298 TGTTAAATAAGCGAAGGGTGGGG + Intergenic
926752391 2:16208461-16208483 TGTAAAATAGGTAAAGGATAAGG - Intergenic
926815399 2:16794571-16794593 GGTAAAATAGGGGAATTGTAAGG + Intergenic
926889915 2:17630052-17630074 TGTAAAATAGGTGAAGGGTGGGG + Intronic
927352817 2:22137888-22137910 AGAAAAAGAGGAGAAGGGTATGG + Intergenic
928346155 2:30498415-30498437 TGTCAAATAGGTGAAAAGTAAGG + Intronic
928459665 2:31458550-31458572 TGTAAAATAGGTGAAGGGTGTGG + Intergenic
928677773 2:33666625-33666647 TGTAAAATAGATGAAAGGCAGGG - Intergenic
928928712 2:36602112-36602134 GGTAAAATGGGGGAATGGTAAGG - Intronic
928941424 2:36730979-36731001 TGTAAAATAGGTGAAGGGTGGGG + Intronic
929076535 2:38083400-38083422 GGTAAAATGGGGGAATGGTAAGG + Intronic
930118939 2:47744096-47744118 TGTAAAATAGGTGAACGGTGAGG - Intronic
930181090 2:48358284-48358306 TGCAAAATAGGTGAATATTAAGG - Intronic
930358972 2:50354419-50354441 TGTAAAAAAGGTTAATTGTAGGG + Intronic
930512277 2:52359742-52359764 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
930556199 2:52898792-52898814 TGTAAAATAGGTGAAGGATGGGG - Intergenic
930677956 2:54224566-54224588 TGTAAAATAGGTGAAGGGTGGGG + Intronic
930818377 2:55621351-55621373 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
930955240 2:57196035-57196057 GGTAAAATGGGGGAATGGTAAGG - Intergenic
930991085 2:57655388-57655410 TGTAAAATAGGTGAAGGATGGGG + Intergenic
931026250 2:58116055-58116077 GGTAAAATGGGGGAATGGTAAGG + Intronic
931057334 2:58487334-58487356 TGTAAAACAGGTGTAGGATGGGG + Intergenic
931102290 2:59015615-59015637 TGAAAAATAGGTGAAGGGTGGGG + Intergenic
931237079 2:60420678-60420700 GGTAAAATGGGGGAATGGTAAGG - Intergenic
931445739 2:62325732-62325754 TCTTAAATAGGTGAAGGCAAGGG + Intergenic
931608798 2:64077815-64077837 GGTAAAATGGGCGAATGGTAAGG + Intergenic
931820221 2:65943934-65943956 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
932295988 2:70623707-70623729 GGTAAAATGGGGGAATGGTAAGG - Intronic
932360729 2:71103592-71103614 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
932869266 2:75380791-75380813 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
932873365 2:75425778-75425800 ATTTAAATAGGTGAAGGGTAGGG + Intergenic
933089492 2:78103616-78103638 TGTAAAATAGGTGCAGGGTGGGG - Intergenic
933103263 2:78287467-78287489 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
933329373 2:80877101-80877123 GGTAAAATGGGGGAATGGTAAGG + Intergenic
933557775 2:83851630-83851652 TGTAAAATATGTGAAAGGCGGGG + Intergenic
933894910 2:86801994-86802016 GGGAAACTGGGTGAAGGGTATGG - Intronic
933920849 2:87043247-87043269 TGTAAAGTAGGTGAAGGATAAGG - Intergenic
933930776 2:87150539-87150561 TGTAAAGTAGGTGAAGGATAAGG + Intergenic
934002149 2:87726652-87726674 TGTAAAGTAGGTGAAGGATAAGG + Intergenic
934028452 2:88019562-88019584 TGTAAAGTAAGTGAAGGGTGGGG + Intergenic
935244225 2:101204294-101204316 TTTTAAATAGGTGAATTGTACGG + Intronic
935529253 2:104212750-104212772 TGTGAAATGGGTGAAGTATAGGG - Intergenic
936362345 2:111814903-111814925 TGTAAGGTAGGTGAAGGATAAGG - Intronic
936906587 2:117542415-117542437 TGTAAAATATGTACAGGGAAGGG + Intergenic
937837213 2:126483434-126483456 TGTAAACTAGGGGAAGGGTGGGG + Intergenic
938568987 2:132544970-132544992 TGTAAAATAGGTGAAGCGTGGGG + Intronic
939060832 2:137419668-137419690 TGTAAAATAGGTGAAGGGTGGGG + Intronic
939113353 2:138033368-138033390 TGTAAAATAGGTGAAGGGTGAGG - Intergenic
939262585 2:139829459-139829481 TGTATAATAGGTGAAGAGTGGGG + Intergenic
939393135 2:141593984-141594006 TATAAAAAAGGTGAAGGGTGGGG - Intronic
939393901 2:141604574-141604596 TGTAAAATAGGTGAAGGTTGAGG - Intronic
939857562 2:147378314-147378336 TGTAAAATAGGAGCTGGGCATGG + Intergenic
939928421 2:148201916-148201938 TGTAAAATAAGTGAAGGGTAGGG + Intronic
940129873 2:150369361-150369383 TGTAAAATAGGCGAAGGCTGGGG - Intergenic
940569849 2:155417233-155417255 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
940683614 2:156818635-156818657 TGTAAAATACGTGAAGAATGGGG + Intergenic
940878549 2:158922615-158922637 CGAAAAATAAGTGAAGGGTAGGG + Intergenic
941829887 2:169943924-169943946 TGAAAAATTGGTCACGGGTAGGG - Intronic
941978428 2:171430844-171430866 TGTAAAATAGGTGAAGGGTGGGG - Intronic
942097506 2:172547745-172547767 TGTAAAGTAGGTGAAGGGTAGGG - Intergenic
943375294 2:187068814-187068836 TGTAAAATGGGTGAAGGTTGGGG + Intergenic
943483713 2:188454441-188454463 TGTAAAATAGGTGAACAGTGGGG + Intronic
943856965 2:192808089-192808111 TATAAAATAGGTAAAAAGTAAGG + Intergenic
943884574 2:193199659-193199681 TGTAAAATAGGTGAAAGTTAAGG - Intergenic
943946709 2:194074443-194074465 TGTAAAATAGGTGAAAGGTGGGG - Intergenic
943985407 2:194611884-194611906 TATAAAGTTGGTGAAGGGTGGGG - Intergenic
945173595 2:207020323-207020345 GGTAAAATGGGGGAATGGTAAGG - Intergenic
945369761 2:209002932-209002954 ATAAAAATAGGTGAAGGGTGGGG - Intergenic
945560245 2:211330502-211330524 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
948432735 2:237930376-237930398 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
948504108 2:238416284-238416306 TGTAAAATAGGTGAAGCGTGGGG + Intergenic
949004903 2:241639838-241639860 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1170076944 20:12429881-12429903 TTTAAAATAGGTGAAGGGTGGGG - Intergenic
1170462671 20:16592312-16592334 GGAAAAATAGGTGAAGAATATGG + Intergenic
1171404215 20:24898965-24898987 TGTAAAATAGGTGAAGGCTGGGG + Intergenic
1171404275 20:24899444-24899466 TATAAAATAGGTGAAGGCTGGGG + Intergenic
1172363574 20:34332133-34332155 TGTAAACTAGGTGAAGGGTGGGG - Intergenic
1172552258 20:35810336-35810358 TGTAAAACAGGTGAAGGGTGGGG - Intronic
1172592800 20:36129206-36129228 GGTAGAATTGGTGAATGGTATGG + Intronic
1173119013 20:40272126-40272148 GGTAAAATGGGGGAAGGGAAAGG - Intergenic
1173938945 20:46894085-46894107 TGTAAAATGGGTGAAACATAGGG + Intergenic
1174891296 20:54398087-54398109 TGTAAAATAAATGAAGGGTAGGG - Intergenic
1175027819 20:55921537-55921559 CGTAAAATAAGTGAAGGATGGGG + Intergenic
1175261629 20:57678189-57678211 TGTAAAACTGGGGAAAGGTAAGG + Intronic
1176211542 20:63925514-63925536 TGTAAAATAGGTGAAGGATGGGG + Intronic
1177031029 21:15982427-15982449 AGTAAAATAGGGGAATTGTAAGG + Intergenic
1177265210 21:18774737-18774759 TGTAAAATCGGTGAAGGGAGGGG - Intergenic
1177286997 21:19064667-19064689 TGTAAAATAGGTGAAGGATGGGG - Intergenic
1177385063 21:20397544-20397566 TGTAAAACAGGTGGAAGGTGGGG + Intergenic
1177506948 21:22031456-22031478 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1177656377 21:24021751-24021773 TGTAAGATAAGTGAAAGCTAAGG - Intergenic
1177854399 21:26384906-26384928 AGGAACATAGCTGAAGGGTATGG + Intergenic
1177854651 21:26387277-26387299 CATAAAATAGGTGAAGGAAAAGG + Intergenic
1178161280 21:29918948-29918970 TGTACAACAGGCGAAGGGGAAGG + Intronic
1178170412 21:30033988-30034010 TATAAAATAGGTGAAAGGTGAGG + Intergenic
1178466585 21:32853866-32853888 TGTAAAATAGGTGAGGGGTGGGG + Intergenic
1178467418 21:32860424-32860446 TGTAAAATAGATGAAGGGTGGGG + Intergenic
1178530031 21:33368484-33368506 TATAAAACAGGTGAAGGGTGGGG - Intergenic
1179354682 21:40648587-40648609 TGTAAAATAGATGAAGGGTGGGG - Intronic
1180251595 21:46593839-46593861 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1182732420 22:32505848-32505870 GGTAAAATAGGGGAATTGTAAGG - Intergenic
1182867713 22:33618846-33618868 TGTAAAATAGGTGAAGGATGTGG - Intronic
1183283095 22:36943367-36943389 TGTAAAATAGGTGAAGGGTGAGG + Intergenic
1184261344 22:43318675-43318697 TGGAAAAAAGGAGAAGAGTAGGG - Intronic
1184578717 22:45397613-45397635 TGTAAAATAGGTGAAGGGTAGGG - Intronic
1184870250 22:47233251-47233273 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
949387149 3:3515667-3515689 TGGTAAAAAGGTGAAGGGTCAGG - Intergenic
949474566 3:4431291-4431313 TGTAAAATTAGTGAAGGATGGGG - Intronic
949996178 3:9619221-9619243 TATAAAATGGGTGAAGGATGGGG - Intergenic
950122905 3:10493670-10493692 TGTAGAATAGATGAAGGGAGGGG - Intronic
950291023 3:11784603-11784625 TAGAAAATAGTTGAAGGGAAGGG - Intergenic
950979575 3:17288483-17288505 TGTAAAATAGGTGAAGGGTGGGG - Intronic
951255801 3:20447949-20447971 TGTGAAATAGGTGAAGTATGGGG + Intergenic
951395995 3:22167205-22167227 TGTAAAATAGGTAAAGGGTGGGG - Intronic
951400817 3:22229828-22229850 TGTAAAAGGGAGGAAGGGTACGG - Intronic
951822099 3:26825199-26825221 TGTAAAATAGGTGAAGAGTGGGG - Intergenic
952657480 3:35803282-35803304 TGTAAAATCGCAGAAGGTTAAGG - Intergenic
953801562 3:46027823-46027845 TGTTAAACAGGTAAAAGGTAAGG - Intergenic
953825564 3:46248943-46248965 GGTAAAATGGGGGAATGGTAAGG + Intronic
954054687 3:48012044-48012066 GGTTAAATAGGTGAAGGATGGGG - Intronic
954606082 3:51910890-51910912 TGTTACATAGGTGAATTGTATGG + Intergenic
955534122 3:59904962-59904984 TGTAAAACAGGTGAAGGGTGGGG + Intronic
955570962 3:60305341-60305363 CATAAAATAGGTGTAGGGTGAGG + Intronic
955578933 3:60397810-60397832 TGTAAAATAGGTGAAAGGTGAGG - Intronic
955922666 3:63973942-63973964 ATAAAAATAGGTGAAGGGTGGGG + Intronic
955934507 3:64089864-64089886 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
956068082 3:65418187-65418209 TGGATAATAGGTGAATGGTGGGG - Intronic
956558206 3:70544114-70544136 CATAAAATAGGTGAAGGGTGGGG + Intergenic
957262384 3:77919171-77919193 TATAAAATAGGTGAAGGATAAGG - Intergenic
957737772 3:84224909-84224931 TGTAAAATAGGTAAAAAGTGGGG + Intergenic
957758990 3:84531083-84531105 TGTAAAATAGGTAAAAGTTAAGG - Intergenic
958025729 3:88046636-88046658 TTTAAAATAGGTGAATGGTGAGG + Intergenic
958170005 3:89927628-89927650 TGTAAAATAGGTGAAGGATGAGG - Intergenic
958592452 3:96175320-96175342 TAAAAAATAGGTGAAGGGTGAGG - Intergenic
958758112 3:98274578-98274600 TGTAAAATAGGTGAAGGGTGAGG - Intergenic
959023958 3:101219453-101219475 CGTAAAATAGGTGAAGGGTGGGG - Intergenic
959062128 3:101625365-101625387 TGTAAAATAGGGGAAGGGTGGGG + Intergenic
959343299 3:105159006-105159028 TGTAAAATATGTCAAAGGTATGG + Intergenic
959468711 3:106721720-106721742 TGTAAAATAGGTGAAAGGTGAGG + Intergenic
959483348 3:106899850-106899872 TGAGGAAGAGGTGAAGGGTAGGG - Intergenic
959693568 3:109224964-109224986 CGTTAAATAGGTGAAGGGTGGGG + Intergenic
959776389 3:110169127-110169149 GAGAAAATAGGTGAAGGGAAGGG - Intergenic
960721385 3:120627643-120627665 TGATAAATGAGTGAAGGGTAGGG + Intergenic
961156642 3:124685195-124685217 TGTAATATATCTGAAGGGTGTGG + Intronic
961164619 3:124755192-124755214 GGTAAAATGGGGGAATGGTAAGG + Intergenic
961730726 3:128962776-128962798 GGTAAAATGGGGGAATGGTAAGG - Intronic
962031018 3:131600317-131600339 TGATACATAGGAGAAGGGTATGG + Intronic
962307878 3:134304646-134304668 TGTCAAATAGGTGAAGGGAAGGG + Intergenic
962693262 3:137922680-137922702 TGCAGAGTAGGAGAAGGGTAAGG + Intergenic
962922579 3:139964429-139964451 TATAAAGTAGGTGCAGGATATGG + Intronic
963107140 3:141657172-141657194 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
964133314 3:153315188-153315210 TGTAAAATAGGTGAAGGGTTGGG + Intergenic
964347571 3:155769896-155769918 TGTAAAATAGGTGGAGGTTGGGG - Intronic
964906383 3:161724519-161724541 GGTAAAATGGGGGAATGGTAAGG + Intergenic
964987865 3:162766522-162766544 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
965039733 3:163490819-163490841 TTTAAAATAGGTGAAGGGTGGGG + Intergenic
965713559 3:171579494-171579516 GGTAAAATGGGGGAATGGTAAGG - Intergenic
966301742 3:178486654-178486676 TGTAAAATATGTGGAAGGAAAGG - Intronic
966755800 3:183370225-183370247 TGTAAAATACATGAGGGGTGGGG - Intronic
966836175 3:184050952-184050974 TGTAAGAAAGGGGAAGGGAAGGG - Intergenic
966849036 3:184153382-184153404 TGTAAAGAAGGTGAAGGAAAGGG + Intronic
967643679 3:191897975-191897997 GGTAAAATGGGGGAATGGTAAGG + Intergenic
967990831 3:195129268-195129290 TGTTAAATGGGTGAATTGTATGG - Intronic
968170648 3:196507096-196507118 TATAAAATAGGTGAAGGGTAAGG + Exonic
968561761 4:1287041-1287063 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
968668925 4:1837612-1837634 TTTAAAATAGTTGAATGTTATGG - Intronic
971001850 4:22332483-22332505 TGTACAATAGGTGAAGGGAGGGG - Intergenic
971109873 4:23572977-23572999 TCTAAAATAGGTGAAGGGTGGGG + Intergenic
971537953 4:27778155-27778177 TTTTAAATAGGTGAACTGTATGG + Intergenic
971689071 4:29809909-29809931 TGTAAACTAGGTGAAAGATAAGG - Intergenic
971724009 4:30284621-30284643 TGAAACATTGGTGAAGGGTCTGG + Intergenic
971859434 4:32085853-32085875 TATAAAATGGGTGAAAGGTAGGG + Intergenic
971860154 4:32091145-32091167 TGTAAAACAGGTGAAGGGTGGGG + Intergenic
972065663 4:34939879-34939901 TGTAAAATAGATGAAGGGTGGGG + Intergenic
972309577 4:37867422-37867444 TGTAAAATAGGTGAAAGATAGGG - Intergenic
973063685 4:45761962-45761984 CGTAAAATAGGTGAAGGGTGGGG + Intergenic
973136064 4:46708550-46708572 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
973238647 4:47933011-47933033 TGTAAAGTAGGTGAAGGGTGGGG + Intronic
973639155 4:52886128-52886150 TGTAAAATAGGTGAAGGGTAGGG - Intronic
973970760 4:56211794-56211816 TGTAAAACAGGGGAAGGATGGGG + Intronic
974421617 4:61683643-61683665 TGTAAAATAGGTGAAGGGTGGGG + Intronic
974456801 4:62139032-62139054 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
975271887 4:72445168-72445190 TTTTAAATAGGTGAATTGTATGG + Intronic
975864436 4:78712390-78712412 TGTAAAATATGTAAAAGATATGG - Intergenic
976884430 4:89967431-89967453 GGTAAAATGGGGGAATGGTAAGG + Intergenic
977217013 4:94295866-94295888 GGTAAAATGGGGGAATGGTAAGG + Intergenic
977225202 4:94386104-94386126 GGTAAAATGGGGGAATGGTAAGG + Intergenic
978000978 4:103556397-103556419 GGTAAAATGGGTGAATTGTAAGG + Intergenic
978216264 4:106208328-106208350 TGTAAAATAGGTGAATGGTAGGG - Intronic
979146751 4:117255167-117255189 GGTAAAATGGGGGAATGGTAAGG - Intergenic
979991132 4:127376966-127376988 TTTTAAATAGGTGAAATGTATGG + Intergenic
980433461 4:132737118-132737140 TGGAAAATTGGTCAAGGGTAAGG - Intergenic
980433555 4:132737817-132737839 TGGAAAATTGGTGAAGGGTGAGG - Intergenic
980481535 4:133394742-133394764 TGTAAAATAGGTGAAGTGTGGGG - Intergenic
980677229 4:136101979-136102001 TGCAAAAAAGCTGAGGGGTAAGG - Intergenic
980729102 4:136804423-136804445 TGTAAAATAGGTAAAGGGTAAGG - Intergenic
981427621 4:144622016-144622038 TATAAAACAGGGGAAGGGTGGGG - Intergenic
981525353 4:145702165-145702187 GGTAAAATGGGGGAATGGTAAGG - Intronic
981862143 4:149369507-149369529 TGTAAAACAAATGAAGGTTAAGG - Intergenic
981963963 4:150579596-150579618 TGTAAAAGTGGAGAAGCGTAGGG + Intronic
982249376 4:153389103-153389125 TGTAAAATAGGTGAAGCGTGCGG + Intronic
982607141 4:157528967-157528989 TATGAAATAGGTGAATGGTGGGG + Intergenic
982656050 4:158151109-158151131 TCTAAAATGGGCGAAGGGAAAGG + Intronic
982758173 4:159249779-159249801 TTTTAAATAGGTGAATTGTATGG - Intronic
982815713 4:159881468-159881490 TGTAAAATAGTTGAATCATAGGG + Intergenic
982901380 4:161007843-161007865 TGTATAATAGTTGAAAGGTGTGG + Intergenic
983333342 4:166359585-166359607 TGTAAAAGAGGTGGAGGATGAGG + Intergenic
983448891 4:167887176-167887198 TGTAAAATAGGTGAAGGATGGGG - Intergenic
983472430 4:168173796-168173818 TGTAAAATAGGTGAAGGCTGGGG - Intronic
983805654 4:171988665-171988687 GGTAAAATGGGGGAATGGTAAGG + Intronic
984400443 4:179257373-179257395 TGTAAAATAGGTGAAGGGTGAGG + Intergenic
984400934 4:179262517-179262539 TGTAAAACAGGTGAAGGGTAAGG + Intergenic
984403370 4:179295359-179295381 TGTAAAATAGGGGAAGGGTAGGG + Intergenic
984700817 4:182817595-182817617 GGTAAAATGGGGGAATGGTAAGG - Intergenic
985057254 4:186046836-186046858 GGTAAAATGGGGGAATGGTAAGG + Intergenic
985101252 4:186460578-186460600 TGTAAAATAGGTAAAGGGTGGGG + Intronic
985582491 5:705862-705884 GGTAAAATGGGGGAATGGTAAGG - Intergenic
986193669 5:5518619-5518641 GGTAAAATGGGGGAATGGTAAGG - Intergenic
986240741 5:5957515-5957537 TGTAAAATAGGTGAAGAGTAAGG + Intergenic
987486403 5:18532731-18532753 TGTAAAATAGGTGAAGGGCAGGG - Intergenic
988088799 5:26508212-26508234 TGTAAAACAGGTGAAGGGTGAGG - Intergenic
988340394 5:29962548-29962570 TGTAAAATAGGTGAAGAGTGGGG + Intergenic
988361285 5:30239655-30239677 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
988681640 5:33489492-33489514 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
988782759 5:34538324-34538346 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
989459757 5:41683768-41683790 TGTAAAATAGGTGAAAGGTAGGG + Intergenic
989585418 5:43070854-43070876 TGTAAAATAGGTGAAGTGTGGGG - Intronic
990176999 5:53119023-53119045 TGTAAAATAGGTGTAGAATGGGG + Intergenic
991040538 5:62170399-62170421 TAGAAAAAAGGTGAAAGGTATGG - Intergenic
991141773 5:63252573-63252595 AGTAAAATCTGTGAAGGATATGG + Intergenic
991205973 5:64050880-64050902 TGTAAAATAGGTGAAGGGTAGGG - Intergenic
991429253 5:66526893-66526915 TGTAAAAGAAGTAAAGGCTATGG + Intergenic
991633856 5:68683366-68683388 TTTAAAATAGGCAAAGGGAAAGG + Intergenic
992231644 5:74670141-74670163 TGTAAAATAGGTGAAGGGTGGGG - Intronic
992843146 5:80716221-80716243 TGAAAGATAGGTGTGGGGTAGGG - Intronic
992927924 5:81609738-81609760 TGTAAAATAGTTGAATGCTGAGG - Intronic
992958288 5:81932906-81932928 TGGAAAATATGAGAAGAGTAGGG - Intergenic
993192859 5:84701552-84701574 GGTAAAATGGGGGAATGGTAAGG - Intergenic
993378286 5:87176042-87176064 TGTAAAATAGCTGAACAGTGGGG - Intergenic
993761585 5:91802564-91802586 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
993937998 5:94026634-94026656 TGTAAAATAGGTGAAGGGTGGGG + Intronic
994236334 5:97368061-97368083 TGTAAAATAAGTGAAAGAAAGGG - Intergenic
994431429 5:99667579-99667601 TGTAAAATAAATAAAGGGCAAGG - Intergenic
994433992 5:99705793-99705815 TGTAAAATAGGTGAAGGGTTGGG - Intergenic
995159969 5:108967806-108967828 AGTAAAACAGGTGAAAGGTGGGG + Intronic
995485178 5:112633201-112633223 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
995554380 5:113312438-113312460 AGTTAACCAGGTGAAGGGTAGGG + Intronic
996250106 5:121318884-121318906 TGTAAAATAGGTGAAGAGTGGGG - Intergenic
996475260 5:123911619-123911641 TGTAAAACAGATGAAAGCTATGG - Intergenic
996626744 5:125579433-125579455 TGTAAAGTAGGAGAATGGAAAGG + Intergenic
997102198 5:130981503-130981525 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
997746541 5:136304386-136304408 GGTAAAATGGGGGAATGGTAAGG - Intronic
998533517 5:142907581-142907603 TCTAACATAGTTTAAGGGTAGGG + Intronic
998898770 5:146829664-146829686 TGTAAAAGAGGCGCAGGTTAAGG + Intronic
999779199 5:154835523-154835545 TCTAAAATAAGAGGAGGGTAGGG - Intronic
999924467 5:156360204-156360226 TGTAAAATAGGCGAAGGGTAGGG - Intronic
1000600856 5:163273170-163273192 TGTAAAATAGGTGAAAGGTGAGG + Intergenic
1000636083 5:163645239-163645261 TGTAAAATAGGTGAAAAGTGGGG - Intergenic
1000869646 5:166559977-166559999 TGTAAAATAGGTAAAGGATGTGG + Intergenic
1001210517 5:169806618-169806640 TGTAAAATAAGCGAAGGGTGGGG - Intronic
1002403781 5:179012395-179012417 TGTAAAACAGGTGAAGGATGGGG + Intergenic
1003791695 6:9553449-9553471 TGCAAAATAGGTGAAGGATGGGG + Intergenic
1004274707 6:14225402-14225424 AATAAAATAGGTGAAGAGTCAGG + Intergenic
1004553373 6:16672064-16672086 TGTTAAATAGGTCAGGGGTGGGG - Intronic
1004983294 6:21050694-21050716 TGTAGAATAGATGAAGGGTGGGG + Intronic
1005026355 6:21466386-21466408 TGTAAAATAGGTGAAGAATGGGG - Intergenic
1005506458 6:26473015-26473037 TGGAAAGTAGTTGAAGGGTGGGG + Intronic
1006908917 6:37551199-37551221 TGTAGAATGGGTGAAGGGGTTGG + Intergenic
1008180241 6:48319244-48319266 TATAAAATAGGGGCATGGTATGG + Intergenic
1008248059 6:49203529-49203551 TGTAAAATAGGTGAAGGGTGAGG - Intergenic
1008273097 6:49512558-49512580 TTTTAAATAGCAGAAGGGTATGG + Intronic
1008846352 6:55968766-55968788 TGTAAAATAGGGTAATGGTAGGG + Intergenic
1009490168 6:64280582-64280604 TATAAAATAGGTCTAGGGAAAGG + Intronic
1009523296 6:64711971-64711993 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1009537625 6:64908861-64908883 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1009636627 6:66274112-66274134 TTTAAAATGGGTGAAGTATATGG - Intergenic
1009802441 6:68556497-68556519 AGTAAAATAGATGAAGACTATGG + Intergenic
1010104452 6:72150275-72150297 TGTAAAATATGTGAAGGGTGAGG + Intronic
1010490164 6:76466345-76466367 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1010570912 6:77474100-77474122 TGTAAAATAAGTGAAGGGTGGGG - Intergenic
1010792641 6:80082410-80082432 TGTAACATAGGTGAAAGTTTAGG - Intergenic
1010829554 6:80512940-80512962 GGTAAAATAGGGGAATTGTAAGG + Intergenic
1010894405 6:81347781-81347803 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1011049237 6:83126258-83126280 TGTAAAATAGGTGAAGAGTGGGG + Intronic
1011748669 6:90433722-90433744 TGTAAAATAGGTGAAGGATGGGG - Intergenic
1012755621 6:103226965-103226987 TGTAAAATAAGTGAAAGATAAGG - Intergenic
1012800104 6:103815325-103815347 TGGAAAATATGTGAAGGCAAGGG - Intergenic
1013546318 6:111161262-111161284 TGTAAAATAGGTGGAGGGTGGGG + Intronic
1014287906 6:119522695-119522717 TTTAAACTGGGTGAATGGTATGG + Intergenic
1014719036 6:124895113-124895135 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1014961487 6:127691649-127691671 TGTAAAACAGGTGAAGGATGAGG - Intergenic
1015353654 6:132251984-132252006 TGTGAAATAGGTGAAGGTTGGGG - Intergenic
1015361471 6:132344607-132344629 TGTTAAATAGGTGAAGGGTGGGG - Intronic
1015409475 6:132876884-132876906 TGTAAAATAGGTGAACAGTAAGG - Intergenic
1016205800 6:141466952-141466974 TGTAAAATAGGTGGAAAGTAAGG + Intergenic
1016206519 6:141473697-141473719 TGTAAAATGGGTGAATGGTGGGG + Intergenic
1016416141 6:143836129-143836151 TGTAAAATAGCTCAAAGATAAGG - Intronic
1016559337 6:145377801-145377823 TGTAAAATACGTGAAAAGTAAGG + Intergenic
1016680253 6:146820802-146820824 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1016702474 6:147069303-147069325 TGTAAAATAGCTGAAGAGTGGGG - Intergenic
1016751351 6:147633839-147633861 TTTAAAACAGGTGAATTGTATGG - Intronic
1017464087 6:154678558-154678580 TTTAAAATAGGTCTTGGGTAGGG - Intergenic
1017741622 6:157411600-157411622 TGAAAAAAAGGTTAAGGTTAAGG + Intronic
1018007690 6:159638595-159638617 AGAAAAATAGGTGAAGAGTCTGG - Intergenic
1018529537 6:164748012-164748034 TGTAAAACAGGTGAAGGCTGGGG + Intergenic
1019076240 6:169390215-169390237 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1019076893 6:169395046-169395068 TATAAAATAGGTGAAGGGTGGGG + Intergenic
1019104293 6:169656254-169656276 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1020067821 7:5202859-5202881 GGCAAAATAAATGAAGGGTATGG + Intronic
1021015360 7:15525369-15525391 TGTAAAATAGTTGAAGGGTGGGG - Intronic
1021054514 7:16030482-16030504 TGTCAAATAGGTGAAGGGTGGGG + Intergenic
1021103576 7:16611736-16611758 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1021147039 7:17101720-17101742 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1021386417 7:20036014-20036036 CGTAAAATAGGTGAAGGGTGGGG + Intergenic
1021813549 7:24426239-24426261 TGTAAAATAGATGAAGAGTTGGG + Intergenic
1021977755 7:26026831-26026853 GGTAAAACAGGGGAATGGTAAGG + Intergenic
1022149190 7:27582180-27582202 TGTATAAGAGTTGAAGGGAAGGG - Intronic
1022705352 7:32796909-32796931 TGTTAAATGGGTGAAATGTATGG - Intergenic
1022709899 7:32840549-32840571 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1022742191 7:33133264-33133286 TGTTAAATGGGTGAATTGTATGG - Intronic
1022980698 7:35602245-35602267 TGTAAAATAGGTGGAAGGTGGGG + Intergenic
1023599338 7:41865717-41865739 TGTAACACAGGTGAAGGGTGGGG + Intergenic
1023677218 7:42643164-42643186 TGTAAAATAGATGAAGGGTGGGG - Intergenic
1023934462 7:44729666-44729688 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1023986249 7:45098518-45098540 TTTTAAATGGGTGAAGTGTATGG + Intergenic
1024739107 7:52336280-52336302 GGTAAAATAGGGGAATTGTAAGG + Intergenic
1024999470 7:55302928-55302950 TGCAGAAGAGGTGAGGGGTAGGG + Intergenic
1025618193 7:63142797-63142819 TGTAAAACAGCTGAAGGGTGGGG - Intergenic
1026918603 7:74138771-74138793 TGTAAAATAGGCGAAGGGTGGGG - Intergenic
1027287702 7:76665917-76665939 TGTAAAATACGTGAAGGATGGGG - Intergenic
1027354563 7:77342769-77342791 GGTAAAATAGGGGAATTGTAAGG - Intronic
1027616769 7:80433638-80433660 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1027632307 7:80621956-80621978 TATAAAATAGGTGAAGGGTGGGG - Intronic
1027672545 7:81119301-81119323 TGTAAAATAGGTGAAGGATGGGG + Intergenic
1027746624 7:82082559-82082581 TGTAAAATAGATGAAGGGTGGGG + Intronic
1027769758 7:82392133-82392155 TGTAAACTAAGTGAAGGGTAAGG - Intronic
1028000747 7:85494833-85494855 TGTAAAATAGGTGAAGAGTGGGG + Intergenic
1028571573 7:92293478-92293500 TAAAAAACAGGTGAAGGGTGTGG - Intronic
1028999641 7:97139486-97139508 TGTAAAATAGGTGAAGGGTGAGG + Intronic
1030056380 7:105587056-105587078 TGTATAATAGGGGAAGGGTGAGG + Intronic
1030249652 7:107428091-107428113 TGTAAAACAGGTGAAAGGTGGGG + Intronic
1030384256 7:108848515-108848537 TGAAAAATTGGTGAAGGGTGGGG + Intergenic
1030385429 7:108862927-108862949 TGTAACCTATGTGAAGGGTGAGG - Intergenic
1030593484 7:111508751-111508773 TGTGAAATAGGTGAATGGTGGGG + Intronic
1030751363 7:113236222-113236244 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1031173977 7:118325459-118325481 TACAAAATAGGTGAAGTGTAGGG + Intergenic
1031174205 7:118328843-118328865 CGTAAAATAGGTGAAGGATGGGG + Intergenic
1031667609 7:124504006-124504028 TGTAAAATTGGCGAAGGGTGAGG + Intergenic
1031748338 7:125535644-125535666 GGTAAAACAGGTGAAGGATAAGG + Intergenic
1031791284 7:126108189-126108211 TGTAAAATAGGGGAAGAGTATGG - Intergenic
1032422655 7:131795167-131795189 TGTGAAAGAGGGGAAGGATAAGG + Intergenic
1032538731 7:132685881-132685903 TATAAAATAGGTGAAGAGTGGGG - Intronic
1033928232 7:146489974-146489996 TGTAAAATCAGTGATGGGTAGGG + Intronic
1034717334 7:153255809-153255831 TGTAAAATAGGTGAAGGGTGAGG - Intergenic
1035790266 8:2297776-2297798 GATAAAATAGGTGAAGGCCATGG + Intergenic
1035802539 8:2423929-2423951 GATAAAATAGGTGAAGGCCATGG - Intergenic
1035812036 8:2500650-2500672 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1036748862 8:11430526-11430548 TTTCAAATAGGTGAACTGTATGG + Intronic
1037301952 8:17461142-17461164 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1037424996 8:18746117-18746139 TGTAAAATACGTGAAGGGTGGGG - Intronic
1038114525 8:24538401-24538423 TGTAAACTATGTGAAGGTAAGGG + Intergenic
1038123666 8:24646602-24646624 CGTAAAATAGCTGATGGGTGGGG + Intergenic
1038216049 8:25562543-25562565 TGTAAAATAGGTGAAGGGTGAGG + Intergenic
1038547358 8:28435726-28435748 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1038627119 8:29204973-29204995 TGTAGAAAAGGTGAAGGGCTGGG - Intronic
1038871162 8:31495230-31495252 TGTAAAATAGATGAAGGGTGAGG + Intergenic
1039494965 8:37973757-37973779 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1040509387 8:48080843-48080865 CGTAAAATAGATGAAGGGTGGGG - Intergenic
1040885348 8:52256805-52256827 TTTTAAATAGGTGAATAGTATGG - Intronic
1041152009 8:54944610-54944632 TGTAAAATTGGTGAAGGGTGGGG + Intergenic
1041654044 8:60330754-60330776 TCTAGAAGTGGTGAAGGGTAGGG + Intergenic
1041983805 8:63895108-63895130 GGTAAAATATGTGAAGGGTGGGG + Intergenic
1042350641 8:67773890-67773912 AGAAAAATAGGTGATGGGTAAGG - Intergenic
1042468161 8:69152405-69152427 TCTAACATATGTGAAGGGCAAGG - Intergenic
1043353522 8:79388740-79388762 GGTAAAATGGGGGAATGGTAGGG + Intergenic
1043499395 8:80837967-80837989 TGTATGATAGGTTTAGGGTAGGG - Intronic
1043687519 8:83106651-83106673 TGTAAAACAGGGGAAGGGTAGGG - Intergenic
1043765664 8:84128868-84128890 TGAGAAATAGGTGAAGAGCATGG - Intergenic
1044091765 8:88010933-88010955 TGTAAAATAGGTGAAAGGTGGGG + Intergenic
1044153689 8:88816108-88816130 TCTAAAATATCTGAAGGGAAGGG + Intergenic
1044199210 8:89413929-89413951 TGTAAAATAGATGAAAGGTAGGG + Intergenic
1044258478 8:90092849-90092871 GGTAAAATGGGGGAATGGTAAGG + Intronic
1044414831 8:91925883-91925905 TGTAAAATAAGTGAAAGGTAAGG - Intergenic
1045272054 8:100670457-100670479 TGTAAAATAGGTGAAGAGTGGGG - Intergenic
1045517360 8:102871914-102871936 TGTAACTTAGGTGATGTGTAGGG + Intronic
1046294259 8:112198899-112198921 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1046406210 8:113775940-113775962 TGTATAATAGGTGAAGGGTGGGG - Intergenic
1046437315 8:114208304-114208326 TGTAAACGTGGTGAAGGGAATGG - Intergenic
1046559413 8:115817674-115817696 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1046690821 8:117282546-117282568 TGTAAAATAGGTGAAGGCTGAGG - Intergenic
1046943752 8:119955821-119955843 TGTTAAATAGGTTAATTGTATGG + Intronic
1047829407 8:128614552-128614574 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1048410683 8:134169094-134169116 TGTAAAATAGGTGAAGGGTAGGG + Intergenic
1048485899 8:134847492-134847514 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1048512002 8:135071546-135071568 TGTAAACTAGATGAAGAGTGAGG - Intergenic
1048712464 8:137227389-137227411 TGTAAATTGGGTGAAGGGTGGGG + Intergenic
1048764097 8:137827460-137827482 GGTAAAATGGGTGAATTGTAAGG + Intergenic
1049610048 8:143550671-143550693 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1049730337 8:144174183-144174205 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1050237504 9:3597426-3597448 TGTAAAATATGTGAAGGATGGGG - Intergenic
1050653234 9:7795714-7795736 GGTAAGATAGGGGAAGGGGATGG - Intergenic
1050656384 9:7833064-7833086 TGTCAAAGAGGTGAAGGGTGTGG - Intronic
1050718747 9:8561131-8561153 AGTAAAATACATGAAGGGTGGGG - Intronic
1050931373 9:11331078-11331100 TGTAAAATAGGTGAAGTATGAGG + Intergenic
1050932708 9:11349821-11349843 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1050994063 9:12191408-12191430 TGTAAAATAGGGGAACAGTGGGG - Intergenic
1051234639 9:14986400-14986422 AGTAAAATAAGTGAAATGTAAGG - Intergenic
1051996159 9:23220133-23220155 AGTAAAACAGGTGAAGGGTGGGG + Intergenic
1052121073 9:24717112-24717134 TGCAAAATAGATAAAAGGTAAGG - Intergenic
1052914347 9:33912925-33912947 TAAAAAAGAGGTGGAGGGTAGGG - Intronic
1052959565 9:34283465-34283487 TTTAAAAAAGGTGAATGTTACGG + Intronic
1053357902 9:37462467-37462489 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1053600052 9:39601742-39601764 TGTAAAGTAAGTGAAGGGTGGGG - Intergenic
1053857703 9:42355598-42355620 TGTAAAGTAAGTGAAGGGTGGGG - Intergenic
1054253473 9:62740642-62740664 TGTAAAGTAAGTGAAGGGTGGGG + Intergenic
1055135541 9:72824759-72824781 TGTAAAATAGGTGAAGGGTGGGG + Intronic
1055451184 9:76432839-76432861 TATAAAATAGGTGAAGGGTGAGG - Intronic
1056044592 9:82703355-82703377 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1056084129 9:83128370-83128392 TATGAAATAGGTGAAGGGTGGGG - Intergenic
1056169332 9:83967829-83967851 TGTAAAATAACTGCAGAGTATGG - Intergenic
1057026559 9:91738470-91738492 TATTAAATAGTTCAAGGGTAAGG - Intronic
1057399815 9:94713095-94713117 TGTAGAAAAGCTGAAGTGTAAGG - Intergenic
1057938932 9:99263666-99263688 TTTTAAATAGGTGAATTGTATGG - Intergenic
1057982226 9:99673234-99673256 GGTAAAATAGGGGAATGGTAAGG - Intergenic
1058268667 9:102941085-102941107 TGTAACATGAGTGAAAGGTAAGG + Intergenic
1058295726 9:103304012-103304034 TGTAATACAGGTGAAGGATGGGG + Intergenic
1058317428 9:103586289-103586311 TGTAATATAGGTGAAGGGTGGGG - Intergenic
1058334096 9:103803855-103803877 TGCAAAATAGGTGAAGCATGGGG + Intergenic
1058588300 9:106533359-106533381 TGTAAAATAGGCGAAGGGTGGGG + Intergenic
1059608680 9:115867642-115867664 TGAAAAATAGGTGAATTTTATGG + Intergenic
1059687813 9:116654363-116654385 TGTAAACTAGGTCAAGAGCAGGG - Intronic
1059982448 9:119787955-119787977 TGAAAAAAGGGAGAAGGGTAGGG - Intergenic
1060486876 9:124053341-124053363 GGTAAAATAGGTGAAGGATTAGG - Intergenic
1060777663 9:126388038-126388060 TGTTAAATAGGTGAATTGCACGG - Intronic
1061044126 9:128155271-128155293 TGTAAAATAGGAGAAGGGTGGGG - Intergenic
1061054072 9:128212790-128212812 TTTAAAATGGGTGAATGGTATGG - Intronic
1061664734 9:132153944-132153966 TGAAAAAGGAGTGAAGGGTAGGG + Intergenic
1185858289 X:3555768-3555790 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1185960551 X:4543117-4543139 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1185991195 X:4894658-4894680 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1186311369 X:8323186-8323208 TGTAAAATAGGTGAAGGGTGGGG - Intergenic
1186784214 X:12942911-12942933 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1186820692 X:13285011-13285033 TGTAAAATCGGTGAAAGGTGGGG - Intergenic
1187086384 X:16047325-16047347 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1187099826 X:16181804-16181826 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1188292288 X:28404441-28404463 TGTACAATAGCTCAAAGGTAAGG + Intergenic
1188417453 X:29953484-29953506 TGTAAAAAGGGGGAAGAGTAAGG + Intronic
1188495459 X:30779206-30779228 TGTAAAATAGGTGAAGGGTGTGG - Intergenic
1188748421 X:33875160-33875182 TTTAAAAAAGGTGAAAGGAAGGG - Intergenic
1188757245 X:33977389-33977411 AGTAAAATAGGTGAAAGATAAGG + Intergenic
1188893843 X:35642998-35643020 TGTAAAATAGGTGAAAGGTGAGG - Intergenic
1188945120 X:36291088-36291110 TGGAAATTAGGTGAAGGTAATGG + Intronic
1189064927 X:37797132-37797154 TGTGAAAAAGGGGAAGGGTGGGG + Intronic
1189396537 X:40628292-40628314 TGTAGAATGGGTGGAGGGCAGGG - Intronic
1189515671 X:41711643-41711665 TGTAAAATAGGTGAGGGGCGGGG - Intronic
1189619382 X:42819075-42819097 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1189676760 X:43468428-43468450 TGTAAAATAGGCAAAGGGTGGGG + Intergenic
1189795640 X:44643708-44643730 TGCAAAATACGTGATGGGTCAGG - Intergenic
1189971366 X:46421220-46421242 GGTAAAATAGGTAAAGGGAGGGG - Intergenic
1190257223 X:48772667-48772689 AGTAAAATGGGTGAAGCATAGGG + Intronic
1190487477 X:50942203-50942225 TGTAAAATAGGAGAAGGGTTGGG + Intergenic
1190705558 X:53024023-53024045 TGTAAAATAGGTGAAGGGTGAGG - Intergenic
1192325533 X:70128709-70128731 TGTAAAATAGGTGAAGGGTGGGG + Intergenic
1193330441 X:80230122-80230144 TGTAAAATAGGTGAAAGGTGGGG - Intergenic
1193485481 X:82080956-82080978 TGTAAAATAGGTAAAGTGTGGGG + Intergenic
1193486120 X:82086979-82087001 TGTCAAATAGGTGAAGTGTGGGG + Intergenic
1193505400 X:82336514-82336536 TATAAAATAGGTAAAGGGTTGGG - Intergenic
1193807556 X:86012955-86012977 AGTAAAATAGGTGAAGGGTGGGG - Intronic
1193877970 X:86885297-86885319 GGAAAAATAGTGGAAGGGTACGG + Intergenic
1194160528 X:90444466-90444488 TGTAAAATAGGAGAAGGATGGGG + Intergenic
1194186111 X:90775960-90775982 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1194227652 X:91280558-91280580 TGTAAAATATGTGAAGTGTGGGG + Intergenic
1194308404 X:92275702-92275724 GGTAAAATGGGGGAATGGTAAGG + Intronic
1195146113 X:102018825-102018847 TGTAAAATAGGCGAAGGGTGGGG + Intergenic
1195388816 X:104339873-104339895 TGGAATATAGGTGAAGGGTGGGG - Intergenic
1195841633 X:109181494-109181516 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1195908538 X:109867860-109867882 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1196164482 X:112523323-112523345 TGTAAAATAGTAGAATGGGAGGG - Intergenic
1196220848 X:113111355-113111377 GGTGAAATAGGGGAATGGTAAGG + Intergenic
1196288805 X:113915204-113915226 TGTAAAATAGGCGAAAGGTGGGG - Intergenic
1197086990 X:122490199-122490221 CTTTAAATAGGTGAATGGTATGG + Intergenic
1197182520 X:123551710-123551732 TCTAAAATAGGAGCAGGCTAAGG - Intergenic
1197383524 X:125775217-125775239 TGTAAAGTAGATGAAGGGTGGGG + Intergenic
1198046941 X:132912900-132912922 TGTAAAATAGGTGAAGGGTGGGG - Intronic
1199353323 X:146831400-146831422 TGTAAAATAGGTAAAGGGTGGGG - Intergenic
1199576617 X:149318734-149318756 GGTAAAATGGGGGAATGGTAAGG - Intergenic
1200506818 Y:4021406-4021428 TGTAAAATAGGAGAAGGATGGGG + Intergenic
1200532704 Y:4358040-4358062 GGTAAAATGGGGGAATGGTAAGG + Intergenic
1200610999 Y:5327425-5327447 GGTAAAATGGGGGAATGGTAAGG + Intronic