ID: 988373984

View in Genome Browser
Species Human (GRCh38)
Location 5:30409393-30409415
Sequence TATGCATATTTGGAGTTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988373978_988373984 17 Left 988373978 5:30409353-30409375 CCTGCAAATCAGAAAGGCATTGC No data
Right 988373984 5:30409393-30409415 TATGCATATTTGGAGTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988373984 Original CRISPR TATGCATATTTGGAGTTGAT AGG Intergenic
No off target data available for this crispr