ID: 988384075

View in Genome Browser
Species Human (GRCh38)
Location 5:30539155-30539177
Sequence GAGAAGAGTACAGTGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988384069_988384075 20 Left 988384069 5:30539112-30539134 CCCCCAGCAGCAGCTGTATGGCA No data
Right 988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG No data
988384066_988384075 25 Left 988384066 5:30539107-30539129 CCCATCCCCCAGCAGCAGCTGTA No data
Right 988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG No data
988384070_988384075 19 Left 988384070 5:30539113-30539135 CCCCAGCAGCAGCTGTATGGCAC No data
Right 988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG No data
988384067_988384075 24 Left 988384067 5:30539108-30539130 CCATCCCCCAGCAGCAGCTGTAT No data
Right 988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG No data
988384072_988384075 17 Left 988384072 5:30539115-30539137 CCAGCAGCAGCTGTATGGCACAA No data
Right 988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG No data
988384071_988384075 18 Left 988384071 5:30539114-30539136 CCCAGCAGCAGCTGTATGGCACA No data
Right 988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG No data
988384065_988384075 26 Left 988384065 5:30539106-30539128 CCCCATCCCCCAGCAGCAGCTGT No data
Right 988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988384075 Original CRISPR GAGAAGAGTACAGTGATTGC AGG Intergenic
No off target data available for this crispr