ID: 988385804

View in Genome Browser
Species Human (GRCh38)
Location 5:30563543-30563565
Sequence CTGGCAAGTCAGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988385801_988385804 -9 Left 988385801 5:30563529-30563551 CCATCTGCAATTAGCTGGCAAGT No data
Right 988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG No data
988385798_988385804 6 Left 988385798 5:30563514-30563536 CCTAGGTTTGCTCACCCATCTGC No data
Right 988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG No data
988385800_988385804 -8 Left 988385800 5:30563528-30563550 CCCATCTGCAATTAGCTGGCAAG No data
Right 988385804 5:30563543-30563565 CTGGCAAGTCAGATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988385804 Original CRISPR CTGGCAAGTCAGATGGAGGC TGG Intergenic
No off target data available for this crispr