ID: 988391527

View in Genome Browser
Species Human (GRCh38)
Location 5:30639879-30639901
Sequence GAAATTTGCAGAACACGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988391527_988391529 4 Left 988391527 5:30639879-30639901 CCGAACCGTGTTCTGCAAATTTC No data
Right 988391529 5:30639906-30639928 TATACTTAATGATCTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988391527 Original CRISPR GAAATTTGCAGAACACGGTT CGG (reversed) Intergenic
No off target data available for this crispr