ID: 988400136

View in Genome Browser
Species Human (GRCh38)
Location 5:30751608-30751630
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988400136_988400141 11 Left 988400136 5:30751608-30751630 CCCTGTTTCATCTAGTAATACAG No data
Right 988400141 5:30751642-30751664 GGACAATAAGAGTGAGCCAGAGG No data
988400136_988400139 -10 Left 988400136 5:30751608-30751630 CCCTGTTTCATCTAGTAATACAG No data
Right 988400139 5:30751621-30751643 AGTAATACAGGATGCACCATAGG No data
988400136_988400144 17 Left 988400136 5:30751608-30751630 CCCTGTTTCATCTAGTAATACAG No data
Right 988400144 5:30751648-30751670 TAAGAGTGAGCCAGAGGGAAGGG No data
988400136_988400143 16 Left 988400136 5:30751608-30751630 CCCTGTTTCATCTAGTAATACAG No data
Right 988400143 5:30751647-30751669 ATAAGAGTGAGCCAGAGGGAAGG No data
988400136_988400142 12 Left 988400136 5:30751608-30751630 CCCTGTTTCATCTAGTAATACAG No data
Right 988400142 5:30751643-30751665 GACAATAAGAGTGAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988400136 Original CRISPR CTGTATTACTAGATGAAACA GGG (reversed) Intergenic
No off target data available for this crispr