ID: 988401977

View in Genome Browser
Species Human (GRCh38)
Location 5:30774822-30774844
Sequence GTCTAAAGACTGTCAATACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988401974_988401977 21 Left 988401974 5:30774778-30774800 CCCTTAAGCAATTTTTAAAATAT No data
Right 988401977 5:30774822-30774844 GTCTAAAGACTGTCAATACAGGG No data
988401975_988401977 20 Left 988401975 5:30774779-30774801 CCTTAAGCAATTTTTAAAATATT 0: 2
1: 0
2: 17
3: 164
4: 1441
Right 988401977 5:30774822-30774844 GTCTAAAGACTGTCAATACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988401977 Original CRISPR GTCTAAAGACTGTCAATACA GGG Intergenic
No off target data available for this crispr