ID: 988410643

View in Genome Browser
Species Human (GRCh38)
Location 5:30881392-30881414
Sequence CAAAGTGAACACAAAGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988410643_988410650 14 Left 988410643 5:30881392-30881414 CCTCCATCTTTGTGTTCACTTTG No data
Right 988410650 5:30881429-30881451 TAAATGGTGCCTTCCTACACTGG No data
988410643_988410651 19 Left 988410643 5:30881392-30881414 CCTCCATCTTTGTGTTCACTTTG No data
Right 988410651 5:30881434-30881456 GGTGCCTTCCTACACTGGTGAGG No data
988410643_988410647 -2 Left 988410643 5:30881392-30881414 CCTCCATCTTTGTGTTCACTTTG No data
Right 988410647 5:30881413-30881435 TGGGCCCACAACAAATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988410643 Original CRISPR CAAAGTGAACACAAAGATGG AGG (reversed) Intergenic
No off target data available for this crispr