ID: 988410647

View in Genome Browser
Species Human (GRCh38)
Location 5:30881413-30881435
Sequence TGGGCCCACAACAAATTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988410642_988410647 26 Left 988410642 5:30881364-30881386 CCAGCACAGAAAGAGAGAATTCA No data
Right 988410647 5:30881413-30881435 TGGGCCCACAACAAATTAAATGG No data
988410643_988410647 -2 Left 988410643 5:30881392-30881414 CCTCCATCTTTGTGTTCACTTTG No data
Right 988410647 5:30881413-30881435 TGGGCCCACAACAAATTAAATGG No data
988410646_988410647 -5 Left 988410646 5:30881395-30881417 CCATCTTTGTGTTCACTTTGGGC No data
Right 988410647 5:30881413-30881435 TGGGCCCACAACAAATTAAATGG No data
988410641_988410647 27 Left 988410641 5:30881363-30881385 CCCAGCACAGAAAGAGAGAATTC No data
Right 988410647 5:30881413-30881435 TGGGCCCACAACAAATTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988410647 Original CRISPR TGGGCCCACAACAAATTAAA TGG Intergenic
No off target data available for this crispr