ID: 988410650

View in Genome Browser
Species Human (GRCh38)
Location 5:30881429-30881451
Sequence TAAATGGTGCCTTCCTACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988410643_988410650 14 Left 988410643 5:30881392-30881414 CCTCCATCTTTGTGTTCACTTTG No data
Right 988410650 5:30881429-30881451 TAAATGGTGCCTTCCTACACTGG No data
988410646_988410650 11 Left 988410646 5:30881395-30881417 CCATCTTTGTGTTCACTTTGGGC No data
Right 988410650 5:30881429-30881451 TAAATGGTGCCTTCCTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988410650 Original CRISPR TAAATGGTGCCTTCCTACAC TGG Intergenic
No off target data available for this crispr