ID: 988410651

View in Genome Browser
Species Human (GRCh38)
Location 5:30881434-30881456
Sequence GGTGCCTTCCTACACTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988410643_988410651 19 Left 988410643 5:30881392-30881414 CCTCCATCTTTGTGTTCACTTTG No data
Right 988410651 5:30881434-30881456 GGTGCCTTCCTACACTGGTGAGG No data
988410646_988410651 16 Left 988410646 5:30881395-30881417 CCATCTTTGTGTTCACTTTGGGC No data
Right 988410651 5:30881434-30881456 GGTGCCTTCCTACACTGGTGAGG No data
988410648_988410651 -6 Left 988410648 5:30881417-30881439 CCCACAACAAATTAAATGGTGCC No data
Right 988410651 5:30881434-30881456 GGTGCCTTCCTACACTGGTGAGG No data
988410649_988410651 -7 Left 988410649 5:30881418-30881440 CCACAACAAATTAAATGGTGCCT No data
Right 988410651 5:30881434-30881456 GGTGCCTTCCTACACTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988410651 Original CRISPR GGTGCCTTCCTACACTGGTG AGG Intergenic
No off target data available for this crispr