ID: 988418312

View in Genome Browser
Species Human (GRCh38)
Location 5:30974452-30974474
Sequence GAGGAGGGAAGGAGTTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988418312_988418317 11 Left 988418312 5:30974452-30974474 CCTCTGCAACTCCTTCCCTCCTC No data
Right 988418317 5:30974486-30974508 TTCGAGTGTCTCCTCCCTTAAGG No data
988418312_988418318 14 Left 988418312 5:30974452-30974474 CCTCTGCAACTCCTTCCCTCCTC No data
Right 988418318 5:30974489-30974511 GAGTGTCTCCTCCCTTAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988418312 Original CRISPR GAGGAGGGAAGGAGTTGCAG AGG (reversed) Intergenic
No off target data available for this crispr