ID: 988422850

View in Genome Browser
Species Human (GRCh38)
Location 5:31027390-31027412
Sequence GCTTGGGCATGCTACTTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988422850_988422853 0 Left 988422850 5:31027390-31027412 CCTTTCAAGTAGCATGCCCAAGC No data
Right 988422853 5:31027413-31027435 ACTGTCTGTACAGTTGTAGCTGG No data
988422850_988422854 10 Left 988422850 5:31027390-31027412 CCTTTCAAGTAGCATGCCCAAGC No data
Right 988422854 5:31027423-31027445 CAGTTGTAGCTGGTGATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988422850 Original CRISPR GCTTGGGCATGCTACTTGAA AGG (reversed) Intergenic
No off target data available for this crispr