ID: 988428567

View in Genome Browser
Species Human (GRCh38)
Location 5:31092518-31092540
Sequence CAGTTTTTATGAAGCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988428567_988428570 -2 Left 988428567 5:31092518-31092540 CCTTCTGGGCTTCATAAAAACTG No data
Right 988428570 5:31092539-31092561 TGAGACCAGCCAGGAATAACGGG No data
988428567_988428569 -3 Left 988428567 5:31092518-31092540 CCTTCTGGGCTTCATAAAAACTG No data
Right 988428569 5:31092538-31092560 CTGAGACCAGCCAGGAATAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988428567 Original CRISPR CAGTTTTTATGAAGCCCAGA AGG (reversed) Intergenic
No off target data available for this crispr