ID: 988430887

View in Genome Browser
Species Human (GRCh38)
Location 5:31117297-31117319
Sequence CTCATCAAGGGGAATTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988430879_988430887 3 Left 988430879 5:31117271-31117293 CCATAATTTCCTGTTGGATGTGG No data
Right 988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG No data
988430878_988430887 4 Left 988430878 5:31117270-31117292 CCCATAATTTCCTGTTGGATGTG No data
Right 988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG No data
988430882_988430887 -6 Left 988430882 5:31117280-31117302 CCTGTTGGATGTGGGTGCTCATC No data
Right 988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG No data
988430876_988430887 10 Left 988430876 5:31117264-31117286 CCTTTTCCCATAATTTCCTGTTG No data
Right 988430887 5:31117297-31117319 CTCATCAAGGGGAATTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988430887 Original CRISPR CTCATCAAGGGGAATTCAAA GGG Intergenic
No off target data available for this crispr