ID: 988433613

View in Genome Browser
Species Human (GRCh38)
Location 5:31148411-31148433
Sequence AGGATTGTAATACTAATAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988433613_988433617 29 Left 988433613 5:31148411-31148433 CCGATTATTAGTATTACAATCCT No data
Right 988433617 5:31148463-31148485 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
988433613_988433618 30 Left 988433613 5:31148411-31148433 CCGATTATTAGTATTACAATCCT No data
Right 988433618 5:31148464-31148486 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
988433613_988433615 2 Left 988433613 5:31148411-31148433 CCGATTATTAGTATTACAATCCT No data
Right 988433615 5:31148436-31148458 CATGTTGAAAGTCACTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988433613 Original CRISPR AGGATTGTAATACTAATAAT CGG (reversed) Intergenic
No off target data available for this crispr