ID: 988436901

View in Genome Browser
Species Human (GRCh38)
Location 5:31186800-31186822
Sequence CTATTATTCCAAATCCATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988436897_988436901 21 Left 988436897 5:31186756-31186778 CCTCATTAAGAAAAATCAGCTTT No data
Right 988436901 5:31186800-31186822 CTATTATTCCAAATCCATAATGG No data
988436899_988436901 -2 Left 988436899 5:31186779-31186801 CCCTGTGGTTGTTCTTCAAGACT No data
Right 988436901 5:31186800-31186822 CTATTATTCCAAATCCATAATGG No data
988436900_988436901 -3 Left 988436900 5:31186780-31186802 CCTGTGGTTGTTCTTCAAGACTA No data
Right 988436901 5:31186800-31186822 CTATTATTCCAAATCCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988436901 Original CRISPR CTATTATTCCAAATCCATAA TGG Intergenic
No off target data available for this crispr