ID: 988441513

View in Genome Browser
Species Human (GRCh38)
Location 5:31239207-31239229
Sequence GGCTGGACACAATATCCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988441513_988441516 6 Left 988441513 5:31239207-31239229 CCTAGAGGATATTGTGTCCAGCC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 988441516 5:31239236-31239258 TTTTACAGTTAAAGAAACTGAGG 0: 6
1: 127
2: 1127
3: 4724
4: 12363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988441513 Original CRISPR GGCTGGACACAATATCCTCT AGG (reversed) Intronic
903770657 1:25762009-25762031 CACTTAACACAATATCCTCTGGG + Intronic
906858878 1:49337530-49337552 GGCAGGACACAGAATGCTCTGGG + Intronic
909679091 1:78271223-78271245 TTCTGGACACCACATCCTCTTGG + Intergenic
911455699 1:98120441-98120463 GGCAGGAAAAAATATCCTTTTGG - Intergenic
912822506 1:112879143-112879165 GGCAGGAAACTATAACCTCTAGG + Intergenic
921108251 1:212005654-212005676 GGCTGGGCACATTCTCTTCTTGG + Intronic
923441166 1:234021908-234021930 AGCTGGGCACAATACACTCTTGG - Intronic
1066443628 10:35461860-35461882 GGCTGGACTCAATAACATCAGGG - Intronic
1067745053 10:48929353-48929375 GGCTGGTCTCAATAGCCTCTAGG + Intronic
1071572123 10:86703118-86703140 GGCTGGGGACAATATTCTGTAGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073475406 10:103749291-103749313 GGCTGGACAAGATGGCCTCTGGG - Intronic
1075535583 10:123269349-123269371 GTCTGGATCCAATACCCTCTCGG + Intergenic
1078382495 11:10857393-10857415 GGCTGGGAACAATACCCTCAGGG + Intronic
1082847732 11:57740161-57740183 GGCTGGAGACAATATCCCTGAGG + Exonic
1089640091 11:119842270-119842292 GGCTGACCACAACATCCGCTAGG + Intergenic
1090040623 11:123287857-123287879 GGCTGGACTCAGTATCTTTTTGG - Intergenic
1097156077 12:57013273-57013295 GGCTGGACAAAATGGCCCCTGGG + Intronic
1106555484 13:30804770-30804792 GGCTGGGCACCGTCTCCTCTGGG + Intergenic
1108248497 13:48541590-48541612 GGAAGGACACAATACCATCTAGG - Intergenic
1111271322 13:85891304-85891326 GGCTGCACACAACATTTTCTGGG - Intergenic
1111940170 13:94599886-94599908 GCCTGGACACATAATCATCTTGG + Intergenic
1113079534 13:106503682-106503704 GGCTGGACAAGATATCCACATGG - Intronic
1113773205 13:112925457-112925479 CGCTGGACACCCTAACCTCTAGG + Intronic
1117108351 14:52421831-52421853 GGCTGAACACAACATCCCCTTGG - Intergenic
1117842406 14:59873413-59873435 GGCTGGAAAGAATTTCATCTTGG - Intergenic
1117932956 14:60865572-60865594 TGCTGGACACTATGTCCTCTTGG + Intronic
1119234612 14:73009128-73009150 GTCTAGACGCTATATCCTCTGGG + Intronic
1121274067 14:92656114-92656136 GGCTGACCACAGTTTCCTCTGGG - Intronic
1121689977 14:95871069-95871091 GGCTGGACACTAAATGCTTTAGG + Intergenic
1122049537 14:99046372-99046394 GGCTGGACAAAATCACCCCTAGG + Intergenic
1125501985 15:40245661-40245683 GGCTGGACGAAACATCCTCCGGG - Intronic
1125735247 15:41920294-41920316 GGCTGGACAGAATTTGCTGTGGG - Intronic
1126659491 15:51018304-51018326 TGCTTAACATAATATCCTCTAGG + Intergenic
1129190091 15:73932095-73932117 GGCTGAACATGATATCCTCCTGG - Intronic
1134478095 16:14593345-14593367 TATTGGACACAATATGCTCTTGG - Exonic
1138693394 16:58789692-58789714 GGCTGGTCTCAAACTCCTCTTGG + Intergenic
1140465174 16:75175359-75175381 GCCTGGAAACTGTATCCTCTTGG - Intergenic
1143840124 17:9725293-9725315 GGCTGGAAACAGAATCTTCTCGG + Intronic
1144061944 17:11590889-11590911 GACTGGCCACCATATCCTCTAGG - Intergenic
1150232880 17:63567872-63567894 GGCTGGTCTCAAATTCCTCTTGG + Intronic
1153147493 18:2050394-2050416 GGCTGGACCCCAAATGCTCTTGG + Intergenic
1154300560 18:13187658-13187680 GGCAGGACACAGTCTCCTCTGGG - Intergenic
1156285430 18:35689977-35689999 GGTTGGACTCAATATCACCTTGG + Intronic
1164707201 19:30328691-30328713 TGCTGGACCCAATATCCACATGG + Intronic
1167140822 19:47649463-47649485 GGCAGGACACAAGATCTTCGAGG - Intronic
1168584865 19:57584034-57584056 GGCTGGAGACAAAACCTTCTGGG - Intronic
1168670007 19:58233844-58233866 GGCTGGACACAATTTCCAAGTGG - Intronic
925701831 2:6646530-6646552 GGCTGACCACAACATGCTCTGGG + Intergenic
927843360 2:26458836-26458858 GGCTGCACGCCATGTCCTCTGGG - Intronic
930029171 2:47047911-47047933 GCCTGGATCCAATATCCTCCTGG - Intronic
934088634 2:88531350-88531372 GGCTGGACACAATACTCTGCAGG + Intergenic
945510009 2:210689425-210689447 GGCAGGAAACAAAATACTCTAGG - Intergenic
945969230 2:216220058-216220080 GGCTGGACAACATATCCGCATGG - Intergenic
946276187 2:218633609-218633631 GGCTGGACACAAGATGGGCTTGG - Exonic
948389634 2:237602716-237602738 CCCTGGACACATCATCCTCTGGG - Intergenic
948491513 2:238316061-238316083 GACTGGAGACCATATACTCTGGG + Intergenic
1170548237 20:17453590-17453612 GGTTGGACACCATATCCTTCTGG - Intronic
1171159295 20:22906970-22906992 GGCTGGACAAGATATTCTCATGG + Intergenic
1177607989 21:23407179-23407201 GTCTGCAAACAACATCCTCTAGG - Intergenic
1181815887 22:25436560-25436582 GACTGGACACAATTCCTTCTAGG + Intergenic
1181815898 22:25436618-25436640 GACTGGACACAATTCCTTCTAGG + Intergenic
1181815910 22:25436677-25436699 GACTGGACACAATTCCTTCTAGG + Intergenic
1181815922 22:25436736-25436758 GACTGGACACAATTCCTTCTAGG + Intergenic
950347757 3:12313691-12313713 GGCTGACCACAACATCCTCCAGG - Intronic
955521860 3:59783107-59783129 GGATGGAAACAAATTCCTCTGGG - Intronic
960966433 3:123108224-123108246 GACTGGGCACAACATTCTCTGGG + Intronic
962567971 3:136682976-136682998 CGCTTAACACAATATCCTCAAGG - Intronic
963718627 3:148833927-148833949 GGCTGGAGACAAATTGCTCTTGG - Intronic
964762602 3:160148530-160148552 GGCTGGACAAAATAACCTCATGG + Intergenic
967344408 3:188438097-188438119 GCCTGGATATAATATCCTTTTGG + Intronic
969472101 4:7394922-7394944 GGCTGTACAAAATCCCCTCTGGG + Intronic
971716298 4:30181428-30181450 GGTTGGACACAGAATCCTTTGGG - Intergenic
973210074 4:47605671-47605693 GGCTGAACACTGAATCCTCTGGG + Intronic
973714210 4:53658875-53658897 GGCTGGAAACAAAATCCTAGAGG - Intronic
978005427 4:103609899-103609921 GGCTTAACATAATGTCCTCTAGG + Intronic
981099306 4:140812762-140812784 TGCTGGACATAATGTCCTCCAGG - Intergenic
986621867 5:9684262-9684284 CACTTAACACAATATCCTCTAGG - Intronic
988441513 5:31239207-31239229 GGCTGGACACAATATCCTCTAGG - Intronic
988949553 5:36242517-36242539 GGCTTGGCACGAAATCCTCTCGG + Intergenic
989311993 5:40030364-40030386 GGCTGAACATAAAATCATCTGGG - Intergenic
989983614 5:50670530-50670552 GCATGGACACAATCGCCTCTTGG - Intronic
991000473 5:61777625-61777647 GTCTGGGCAGAATATCCTCCTGG + Intergenic
991678483 5:69113217-69113239 GGCTGAACACCGTATCCTTTTGG + Exonic
1000348543 5:160334265-160334287 GGTTGTACACAATCTCCACTAGG + Intronic
1001667848 5:173448230-173448252 CACTTGACATAATATCCTCTAGG + Intergenic
1005995255 6:30926926-30926948 TGCTGGACAGAATGTACTCTGGG - Intergenic
1006405329 6:33841681-33841703 GGCTGGACAGAAGATGGTCTGGG - Intergenic
1006993157 6:38232905-38232927 GGGTGAACACAGCATCCTCTGGG - Intronic
1011739000 6:90340644-90340666 AGATGAACACAATATCCTATTGG + Intergenic
1016024257 6:139269756-139269778 GGATGCACACAGTATCATCTTGG + Intronic
1018566630 6:165161686-165161708 GGCTGGACACACGGTGCTCTGGG - Intergenic
1024507339 7:50173060-50173082 AGCTGGAAACTATGTCCTCTAGG + Intergenic
1037038012 8:14191854-14191876 GACTGGACTCCATATCCTGTAGG + Intronic
1037624902 8:20598120-20598142 GGTTGGACTCCATAACCTCTAGG + Intergenic
1041726215 8:61020008-61020030 GCCTGGACTCATTCTCCTCTTGG + Intergenic
1050758562 9:9038116-9038138 GTCTGGATTCAAAATCCTCTAGG + Intronic
1050975066 9:11927864-11927886 TTCCGGACACAATATCATCTAGG - Intergenic
1052482406 9:29047889-29047911 GGCTGGTCTCAAACTCCTCTTGG - Intergenic
1053407038 9:37886306-37886328 GGCTGGAGACAATATCCCTGAGG + Intronic
1055831081 9:80379504-80379526 GGCTGGACACAATGTGCTGGAGG + Intergenic
1058526603 9:105865428-105865450 GGCTGGACAAACTCACCTCTGGG - Intergenic
1059234166 9:112748285-112748307 AGCTGGCCACAATATCCAGTGGG - Intergenic
1187167188 X:16815075-16815097 GGCTTGACACCATATTTTCTGGG + Intronic
1198130844 X:133693715-133693737 GACTGGTGAAAATATCCTCTTGG + Intronic