ID: 988444175

View in Genome Browser
Species Human (GRCh38)
Location 5:31266646-31266668
Sequence AAAAGTTTTCTGGTCAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988444171_988444175 12 Left 988444171 5:31266611-31266633 CCTATAGTATTATTAGGTCCTCT 0: 1
1: 0
2: 0
3: 11
4: 91
Right 988444175 5:31266646-31266668 AAAAGTTTTCTGGTCAAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 258
988444170_988444175 16 Left 988444170 5:31266607-31266629 CCATCCTATAGTATTATTAGGTC 0: 1
1: 0
2: 0
3: 4
4: 69
Right 988444175 5:31266646-31266668 AAAAGTTTTCTGGTCAAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 258
988444169_988444175 17 Left 988444169 5:31266606-31266628 CCCATCCTATAGTATTATTAGGT 0: 1
1: 0
2: 1
3: 9
4: 181
Right 988444175 5:31266646-31266668 AAAAGTTTTCTGGTCAAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 258
988444173_988444175 -6 Left 988444173 5:31266629-31266651 CCTCTAAGGAAAAAAAAAAAAGT 0: 1
1: 3
2: 59
3: 867
4: 6386
Right 988444175 5:31266646-31266668 AAAAGTTTTCTGGTCAAGTTTGG 0: 1
1: 0
2: 1
3: 16
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988444175 Original CRISPR AAAAGTTTTCTGGTCAAGTT TGG Intronic
903042350 1:20540851-20540873 AAATGATCCCTGGTCAAGTTTGG + Intergenic
908013359 1:59806480-59806502 AAAAGTTTCCTGGCCAAGCGCGG - Intergenic
908421406 1:63962106-63962128 AAAAGTTATCTGGGCATGTTAGG + Intronic
910222820 1:84905447-84905469 AAAATTTTTTTGGTCATTTTAGG - Intergenic
910521486 1:88126939-88126961 AAAATTTTTCTTGTGAATTTGGG - Intergenic
910796835 1:91105860-91105882 AAAAGTTTTATGGACACCTTAGG + Intergenic
912987167 1:114445410-114445432 AAAAATTTTCTGGTAGAGATGGG + Intronic
913038718 1:115002141-115002163 AAAAGTATTTTCCTCAAGTTGGG - Intergenic
914891092 1:151624135-151624157 AAAAATTTTTTTGTAAAGTTAGG + Intronic
915378003 1:155414823-155414845 AAATATTTTCTGGTTGAGTTAGG - Intronic
915418302 1:155759279-155759301 AAAAATTTTTTGGCCAAGTGTGG + Intronic
916243756 1:162665949-162665971 AAAAGGGCTCTGGTCATGTTAGG - Intronic
916398255 1:164415659-164415681 AAAAGTTTTAGGGTCGAGCTGGG + Intergenic
916921172 1:169468783-169468805 AAAAATATCCTGGTCAACTTGGG - Exonic
917584151 1:176408362-176408384 AAGAGTTTTCTGGTCATTTTAGG + Intergenic
917858137 1:179118843-179118865 ACAATTTTTCAGGTCTAGTTCGG + Intronic
918174996 1:182035818-182035840 AAAAGTTTTTTTTTCCAGTTGGG - Intergenic
918369446 1:183844553-183844575 AAAACTCCTATGGTCAAGTTTGG - Intronic
921094820 1:211877335-211877357 TCAAGTTTCCTGTTCAAGTTTGG - Intergenic
921292287 1:213670029-213670051 AAAAGTTTCCTGAGCAATTTGGG - Intergenic
921331065 1:214036801-214036823 AAGAATTTTATGGCCAAGTTGGG - Exonic
921375250 1:214466621-214466643 AAAAGTTTTCTGGACATTTCTGG - Intronic
921589048 1:216982338-216982360 AAAAGTTTTATGTTCTAGATGGG + Intronic
921745603 1:218737153-218737175 AAAGGTTTTGTGGACAAGGTGGG + Intergenic
922252588 1:223863661-223863683 TATTGTTTTCTGCTCAAGTTAGG + Intergenic
924654309 1:245959354-245959376 CAAAGTTTTCTGATGAAGATGGG + Intronic
1064384179 10:14876696-14876718 AAAAGATTTCTGGGTAAGTGGGG + Intergenic
1064856445 10:19773581-19773603 AAAAGTTTTTTGGCCCATTTAGG + Intronic
1065489014 10:26263923-26263945 AAAAGTTTTTTTGTTAAGTCGGG + Intronic
1069223581 10:65913317-65913339 AAAATTTTCTTGGGCAAGTTGGG - Exonic
1070046915 10:72847279-72847301 TAATGATTTCTGATCAAGTTGGG + Intronic
1070127928 10:73636744-73636766 AAAAGTATTTGGGTCAAGTGTGG - Intronic
1070518546 10:77230580-77230602 TAAAGTTTGCCGGTGAAGTTGGG + Intronic
1071078280 10:81780822-81780844 GAAAGTGTTCTGATAAAGTTAGG - Intergenic
1071311019 10:84343800-84343822 AAAAGTTTGCAGGTAACGTTTGG + Intronic
1072042170 10:91618128-91618150 AAATGTATTATGATCAAGTTGGG - Intergenic
1073209581 10:101788440-101788462 AAAAGTTTTCTGGCCAGGCGTGG + Intronic
1074682224 10:115918782-115918804 AGAAGTTTGCTGGTGAAGCTGGG + Intronic
1074952616 10:118353924-118353946 AAGAGTTTTTTGGTAAAGGTAGG + Intergenic
1075583095 10:123636908-123636930 AAAAGTGTTCTGGTCAGCTATGG + Intergenic
1076048079 10:127310970-127310992 AAAAGTGTTGAGTTCAAGTTTGG - Intronic
1077736606 11:4798337-4798359 AAAATTTTTCATGTCAAGGTGGG + Intronic
1078306144 11:10188469-10188491 CAAAGTTTTCTTGTCATGCTAGG - Intronic
1081088591 11:38832594-38832616 AAAATTTATTTGGTCAAATTAGG + Intergenic
1082119924 11:48368966-48368988 AAAAGTTTTATTATCAAGTCAGG + Intergenic
1082254363 11:50016254-50016276 AAAAGTTTTATTATCAAGTCAGG - Intergenic
1083014706 11:59441130-59441152 CAAATTTTTCTGCTCAATTTAGG - Intergenic
1083389784 11:62339411-62339433 CAAAGTTTTCAGGTTAACTTTGG + Intronic
1084988907 11:72904320-72904342 AATAGTTTTGAGGACAAGTTTGG - Intronic
1087521178 11:99238598-99238620 AACTGTTTTCTTGCCAAGTTAGG - Intronic
1087815963 11:102659372-102659394 AATAGTATTCTGGTGAGGTTTGG + Intergenic
1088256117 11:107904951-107904973 AAAAGTTAGCTGGTCATGGTGGG - Intronic
1089553777 11:119303000-119303022 AAAAGATTTCTGGTTAAGGGAGG + Exonic
1090158094 11:124463133-124463155 ATAAGTCTTCTGGAAAAGTTAGG - Intergenic
1090399829 11:126441980-126442002 AAACCTTTTCTGGTCAGGTGCGG + Intronic
1090551562 11:127825765-127825787 AAATGTTTTCTGGACTATTTTGG + Intergenic
1092615990 12:10216073-10216095 GAAAGTTTTCTTTTCAAGCTGGG + Intronic
1094031652 12:26018861-26018883 AAAGGCTTACTGGGCAAGTTTGG - Intronic
1094034907 12:26058195-26058217 AAGAGTTGTTTGGCCAAGTTTGG - Intronic
1096467484 12:51855329-51855351 AAAAGTTTCCTGGCCAGGTGCGG + Intergenic
1097902465 12:64886955-64886977 AAAAGTCTTCTCTTCAATTTGGG + Intergenic
1099057399 12:77861296-77861318 ACAAAACTTCTGGTCAAGTTTGG - Intronic
1099698780 12:86058147-86058169 TACAGTTTTCTGGCCAATTTAGG - Intronic
1099933810 12:89102416-89102438 TACAGTTTTCTGGAGAAGTTTGG + Intergenic
1100322869 12:93513475-93513497 AAAAGTTTTTAGGTCAAGCAAGG - Exonic
1100325905 12:93539719-93539741 AAAAGCTTTCTTGGCAAGTTTGG - Intergenic
1100585648 12:95977026-95977048 AAAGGTTTGTTGGCCAAGTTTGG + Intronic
1103104499 12:118211232-118211254 AAAACTTTTCTGGAAATGTTTGG - Intronic
1103801204 12:123538711-123538733 AAAAGTTTTTAGGTCAGGTGTGG + Intergenic
1105218952 13:18307828-18307850 GAAAGTTTTCTGTTCAGATTTGG + Intergenic
1106098808 13:26675977-26675999 AAACATTTTCTGGCCAAGTAGGG + Intronic
1106865594 13:33960567-33960589 CTAAGATTTCTGGTCATGTTGGG + Intronic
1109117684 13:58409567-58409589 AAAAGTTTTCAGGTCTTGCTAGG - Intergenic
1110301282 13:73930466-73930488 AAAAGTTTTTTATTCAATTTGGG + Intronic
1111173964 13:84567695-84567717 AAAGGTGATCTTGTCAAGTTAGG + Intergenic
1111498321 13:89083672-89083694 AAAAGGTTTGAGGTCATGTTAGG - Intergenic
1112037225 13:95507911-95507933 AAAAGTTTTTTGGCCAGGCTTGG - Intronic
1114672831 14:24421186-24421208 ATAAGCTATCTGGTGAAGTTGGG + Intergenic
1115264491 14:31487170-31487192 AAAACTTTTCTGATCAATGTTGG + Intronic
1115717147 14:36118762-36118784 GAATGTTTTCTGATCAAATTTGG + Intergenic
1118124480 14:62885505-62885527 AAAAGTTTTGTCATCAAGTATGG - Intronic
1118147834 14:63159232-63159254 AAAAGTTTTCTGGATAAGGCAGG - Intergenic
1118671486 14:68132877-68132899 AAAAATTCTCTGGTCCAGGTTGG + Intronic
1121189140 14:92009105-92009127 TAAAGTTATCTGTTCAAATTAGG + Intronic
1124371054 15:29104911-29104933 AAAAGTTTTCTTGTAGAGATAGG - Intronic
1125502126 15:40246382-40246404 AAAAGTCTTCTTGTCTAGCTTGG - Intronic
1126562204 15:50056148-50056170 ACACGTTTTCTGCTCAAGTCTGG - Intronic
1126711454 15:51461539-51461561 ATAAGATTTCTGGTCAATTAGGG - Intronic
1127870111 15:63065236-63065258 AAAAGTTTAATGTTTAAGTTTGG - Intronic
1128777198 15:70329513-70329535 ATAAGTTGTCTGGCCAACTTGGG - Intergenic
1128937978 15:71764272-71764294 AAATGTTTTTTGTTCATGTTTGG - Intronic
1128952424 15:71900142-71900164 ATAAGTTTTCTGGCCAGGTGCGG + Intronic
1129314560 15:74733502-74733524 AAAAGTTTGCTGGTGAAGGGAGG - Intergenic
1130160900 15:81398904-81398926 AAAAGTTTTCTAGCACAGTTTGG + Intergenic
1134349093 16:13419948-13419970 AAAAGTTGTTTGCTCAAGCTGGG + Intergenic
1134617389 16:15662108-15662130 AAAAGTTTTTTTGTCAAGGTAGG + Intronic
1136524694 16:30821423-30821445 AGCAGCTTTCTGGTCAAGGTTGG - Intergenic
1139746464 16:69078623-69078645 AAAAGGCTTCTGGTCTAGTGGGG - Intronic
1142685185 17:1573527-1573549 GAAAGTATTATAGTCAAGTTTGG - Intronic
1142732005 17:1865948-1865970 TAAAGTTTTCTGGCCAGGTGTGG + Intronic
1143060469 17:4196360-4196382 AAAAGATTTTTTGTAAAGTTTGG - Intronic
1146488959 17:33266144-33266166 TTAAGTTTTGTGGTCAAGGTAGG - Intronic
1146954574 17:36929939-36929961 AAAAGATTTCTGGTGAAGGGGGG + Intergenic
1150600233 17:66644827-66644849 AAAAGTCTTATGTTCAAGCTGGG + Intronic
1152889315 17:82871460-82871482 AAAAGTTGTCAGGTGAAGTGCGG - Intronic
1153152350 18:2109648-2109670 AAAAGTTTTCTAGTTAAATTAGG - Intergenic
1153938856 18:9958777-9958799 AAAGCTTTGCTTGTCAAGTTAGG + Intronic
1154340179 18:13496297-13496319 AAAATTGTTCTGGGCAAGTAAGG - Intronic
1154932237 18:21011744-21011766 TAAAGTTTTTAGGTCAAGTGTGG - Intronic
1156428421 18:37042771-37042793 AATGTTTTTCTGGTCAAATTAGG + Intronic
1157149971 18:45206913-45206935 AAGAGTATTCTGGTCCAGTGAGG + Intergenic
1158227416 18:55215408-55215430 GAAAGTTCCCTGGGCAAGTTGGG + Intergenic
1158906996 18:62023024-62023046 AAAAGTTGTCTGTGCATGTTTGG + Intergenic
1158930362 18:62319256-62319278 AAAAGTTTTCATGTTATGTTGGG + Intergenic
1162732059 19:12724191-12724213 AAGAGCTTTCTGGTCAAATTTGG + Intergenic
1163228784 19:15983870-15983892 AAAAATTATTTTGTCAAGTTGGG - Intergenic
1165367250 19:35375811-35375833 CAAAGGTTTCTGGTCACGCTTGG - Intergenic
1165753359 19:38275716-38275738 AAAAATTTTTTTGTCAAGCTGGG - Intronic
1166325457 19:42047677-42047699 AAATGTATTCTGGCCAAGTGCGG + Intronic
1166735676 19:45082909-45082931 AAAAGTTTTCTAGCCAGGTGCGG - Intronic
1167062167 19:47156027-47156049 AAAAGTTTTCTGGTCGGGCATGG - Intronic
927537825 2:23877882-23877904 AAAAATTTTTTTGTAAAGTTGGG - Intronic
928581488 2:32712191-32712213 AAACATTTTCTTTTCAAGTTTGG - Intronic
929584671 2:43106197-43106219 AAAAGTCCTCTTGCCAAGTTTGG + Intergenic
929603695 2:43220732-43220754 AAAAGTTTTCTTGTAAATTAAGG - Intergenic
930169548 2:48237036-48237058 AATGGTTTTCTGGCCAAGTGCGG + Intergenic
932287306 2:70546843-70546865 AAAGGTTTTCTGGCCAAGCAAGG - Intronic
933536311 2:83579245-83579267 AAAAGTTTTCTGTGAAGGTTAGG + Intergenic
934885998 2:98025470-98025492 CAAAGTGTTCTGGTCAGGTGTGG - Intergenic
939225588 2:139359868-139359890 TAAAGTATTCTAGTCAACTTTGG - Intergenic
940172642 2:150845461-150845483 AAAAGTCTGCTGGTATAGTTGGG + Intergenic
940196703 2:151103248-151103270 AAAAGTTTTCTGCAGAACTTGGG + Intergenic
941159853 2:162023886-162023908 AAAATGTTTCTGTTCTAGTTGGG - Intronic
941621995 2:167788781-167788803 ATAAATTTTCTGGTCACTTTGGG - Intergenic
942267365 2:174242076-174242098 AAAAGGCTGCTAGTCAAGTTTGG + Intronic
942635640 2:178001829-178001851 CAAAGTTTTGTGGGCAAGTTGGG - Intronic
943716014 2:191152486-191152508 AAAAGTTTCCTGGATAGGTTGGG - Intergenic
944591044 2:201218209-201218231 GAAAGTTTTCTGGCCAGGTGTGG - Exonic
947144672 2:227053834-227053856 AAAAGTTTTCTGGCCAGGTGTGG - Intronic
947304056 2:228723807-228723829 AAAGGTCCTCTGGTCAAATTAGG + Intergenic
1171724003 20:28598274-28598296 AAAAGTTTTCTGCCTAAGCTTGG + Intergenic
1173056881 20:39623189-39623211 AAAAGTTTTGATGTCATGTTGGG + Intergenic
1176758659 21:10748698-10748720 AAAAGCTTTGTGGTCTATTTTGG + Intergenic
1178426162 21:32479969-32479991 AAACTTTTTCTGGATAAGTTTGG + Intronic
1178952073 21:36993338-36993360 AAAACGTTTCTGCTCATGTTAGG - Intergenic
1179215742 21:39365953-39365975 ATAAGTTTAGTGGCCAAGTTTGG - Intergenic
1180297558 22:10956968-10956990 AAAAGTTTTCTGCCTAAGCTTGG + Intergenic
1183495446 22:38140871-38140893 AAAATTTTTTTGGTAAAGATGGG - Intronic
1184878447 22:47290080-47290102 AATAGCTTTCTGGTCAAGTCTGG - Intergenic
955571276 3:60309467-60309489 AAAAGTTTTGTCGTCATCTTGGG - Intronic
956097070 3:65727989-65728011 AAATGTTTCCTGGTCTATTTTGG - Intronic
956532529 3:70236584-70236606 AAAAGTTTTCTAGTAAAATAAGG - Intergenic
956680111 3:71771047-71771069 AATACTTTTCTGACCAAGTTTGG + Intergenic
957481090 3:80795353-80795375 AAAAGATCTCTATTCAAGTTAGG - Intergenic
958531159 3:95332203-95332225 AACAGTTTTCTGTAAAAGTTTGG + Intergenic
958964773 3:100547039-100547061 AAAAGGCTTCCAGTCAAGTTTGG - Intronic
960595977 3:119408477-119408499 AAAAGTTTGTTGGTTAAGATTGG - Intronic
960616114 3:119597638-119597660 AATAGTTTCCTGATCATGTTTGG + Intergenic
960622764 3:119652709-119652731 AGAAGGTTTCTGGACTAGTTAGG + Intronic
960737107 3:120793007-120793029 AAAAGTATTTTGGGCCAGTTTGG + Intergenic
962169212 3:133082942-133082964 AAAAGTTTACAGGCCAAGTATGG - Intronic
962543185 3:136404084-136404106 CAATGATTTCTGGACAAGTTAGG - Intronic
963622394 3:147627454-147627476 AAAAGGTTGATGGTCATGTTTGG + Intergenic
964263519 3:154868592-154868614 AAAATTTTTCTGGCCAGGTGCGG + Intergenic
964955623 3:162352329-162352351 AAAAGTTGTCTGATTAGGTTAGG + Intergenic
965041383 3:163511693-163511715 CAAAGTCTGCTGGTCAAGATTGG - Intergenic
965062376 3:163801411-163801433 CACAGTTTTCTAGTCAAGGTAGG + Intergenic
965743523 3:171901436-171901458 AAAAGCATTCTGGTCATTTTGGG + Intronic
965827557 3:172746073-172746095 AATATTTTTCAGGTCAAATTGGG + Intergenic
968454846 4:692274-692296 AAAGGATCTCTGGTCAGGTTTGG + Intergenic
968874738 4:3260278-3260300 AAAAGTTTTCGGGAGAAGTGTGG + Intronic
970402212 4:15728300-15728322 AATAGTTTTGTGGTAAATTTAGG + Intronic
971134321 4:23850869-23850891 AAAAATGTTCTGGATAAGTTAGG - Intronic
971628116 4:28950422-28950444 AAAAGTTGTAAGGTCATGTTAGG - Intergenic
975325435 4:73053675-73053697 AAAAGTCTTCTCCCCAAGTTTGG + Intergenic
976370342 4:84280745-84280767 AAAAGTTTTATGGCCAAGTGTGG + Intergenic
978517052 4:109579862-109579884 AAAAGTTTTATGTTCATTTTTGG - Intronic
979001753 4:115229993-115230015 GAAATTTTTCTGGGCAAGTAAGG + Intergenic
980040205 4:127930367-127930389 AAAAGATTCATGGTTAAGTTTGG - Intronic
981588721 4:146332747-146332769 AAAAGTTTTCTTGACAAGCATGG - Intronic
983285077 4:165728922-165728944 AAAGGTTTTCTGTACAAATTTGG + Intergenic
984983666 4:185306747-185306769 AAAAGTTTTCTTGAAAAATTAGG + Intronic
985080501 4:186259804-186259826 AAAAGTTTTCTGAAAGAGTTTGG + Intergenic
985990995 5:3561120-3561142 AAATGTTTTGTGATCAAGTCAGG + Intergenic
987378110 5:17256664-17256686 AAACGATTTCTGTTCAACTTGGG - Intronic
987887511 5:23831012-23831034 AAAAGTAGTCTGGCCAAGTAGGG - Intergenic
988444175 5:31266646-31266668 AAAAGTTTTCTGGTCAAGTTTGG + Intronic
993941142 5:94060534-94060556 AAAATTTTTCAGGTCAAGAAAGG + Intronic
994191909 5:96878311-96878333 TAAAGGTTGCTGGTCAAGGTAGG - Intronic
994222372 5:97210589-97210611 ACAAGTCTTCTGGTCTACTTAGG + Intergenic
995186208 5:109273824-109273846 AAAAGTTTTTTGGTGGAGTTAGG - Intergenic
995619638 5:114010378-114010400 AAAATCTTTCTAGTCAAATTGGG + Intergenic
996430821 5:123374743-123374765 GAAAGGTTTCTGTTCAACTTTGG - Intronic
996863937 5:128096628-128096650 AAATGTTTTCTGGCAAAGCTGGG + Intronic
997154966 5:131545768-131545790 AGAAGCTTTTTGGTCATGTTAGG - Intronic
997274324 5:132571470-132571492 AAAAATTTTTTGGTGAAGCTAGG + Intronic
999429524 5:151514022-151514044 AATACTTTTCTGGTCACTTTGGG + Intronic
999808914 5:155109725-155109747 AGAAGTTTTCTTGTCTTGTTAGG + Intergenic
1000634703 5:163630722-163630744 GATAGTTTTCTGGTAAACTTGGG + Intergenic
1002627343 5:180539462-180539484 AATAGTTTTTTGGGCATGTTTGG + Intronic
1002702190 5:181131978-181132000 AAGAGTTTTCTGGTGACTTTGGG + Intergenic
1002894897 6:1372233-1372255 AGCTGTTTTGTGGTCAAGTTTGG + Intergenic
1004779395 6:18891560-18891582 AAATGTATTCTGGTATAGTTTGG + Intergenic
1005437020 6:25824002-25824024 AAAAGTTTTCTCAACAAATTGGG + Intronic
1005508868 6:26494156-26494178 AAAAGTCTTAGGGCCAAGTTTGG - Intergenic
1010730668 6:79387436-79387458 AAAAGATTTATAGTCAAGTTAGG + Intergenic
1010833655 6:80560231-80560253 CAAAGTTTTTCGGTCAAGTGAGG - Intergenic
1011216359 6:85009887-85009909 AAAAGTTTTCTGAGCAGTTTTGG + Intergenic
1011577861 6:88824434-88824456 AACAGTGTTTTGGTCAACTTTGG - Intronic
1011852575 6:91648574-91648596 AAAAGATATCTGGTCAATTTTGG - Intergenic
1012431858 6:99172290-99172312 AACAGATTTCTGGTAAAATTTGG + Intergenic
1012639793 6:101595437-101595459 AACAGATAGCTGGTCAAGTTTGG + Intronic
1014181001 6:118384291-118384313 AAAAGTTTTCTGGTCACGAAGGG + Intergenic
1014284390 6:119480021-119480043 AAAAGTTTACTGTTCCAGTTAGG + Intergenic
1014303237 6:119709973-119709995 ATAAGGCTTCTGGTCAGGTTAGG + Intergenic
1014774003 6:125487830-125487852 AAAAGTTTTTCATTCAAGTTTGG - Intergenic
1015156457 6:130101775-130101797 GAGTGTTTTCTGCTCAAGTTAGG + Intronic
1019217738 6:170454474-170454496 GAATGTTTTCTGTTCATGTTTGG - Intergenic
1019722459 7:2581543-2581565 AAAAGTTGTCTGTTCAAGCCTGG + Intronic
1022743825 7:33149309-33149331 AGAAATTTGCAGGTCAAGTTGGG + Intronic
1024448810 7:49514687-49514709 AACAGTTTTGTGGACAATTTGGG - Intergenic
1024673249 7:51615766-51615788 TAAAGTTTTATGGCCATGTTAGG + Intergenic
1026301174 7:69099548-69099570 AAATGTTTTCTAAACAAGTTCGG + Intergenic
1026556797 7:71415553-71415575 ACAAGGATTCTGGCCAAGTTTGG + Intronic
1027963390 7:84975361-84975383 AAAAGTTTTTTTTTCCAGTTAGG + Intergenic
1028433077 7:90770809-90770831 AAAAGTTTCCTGGTATAGATGGG - Intronic
1030519528 7:110580804-110580826 AATAATTTTCTTTTCAAGTTAGG - Intergenic
1031119060 7:117699882-117699904 AAAAATTATCTTCTCAAGTTAGG + Intronic
1032214917 7:129950526-129950548 AAAAGGCATCAGGTCAAGTTAGG + Intronic
1033719163 7:144038708-144038730 AAAAGTTTCCTGGATATGTTAGG + Intergenic
1037167556 8:15849004-15849026 AAAAGTATTCTGGGCATGTGAGG - Intergenic
1038079476 8:24117440-24117462 AAAAGATATCCGGCCAAGTTTGG - Intergenic
1038246255 8:25859157-25859179 AAACATTCTGTGGTCAAGTTAGG + Intronic
1042879796 8:73474334-73474356 AAAAGTTGAGTGATCAAGTTTGG + Intronic
1042890702 8:73607326-73607348 AAATGTTTTATACTCAAGTTGGG + Intronic
1043395880 8:79835507-79835529 AAAAAATTTCTAGTCAAATTGGG + Intergenic
1044146879 8:88727249-88727271 AAGAGTGTTCTGTTTAAGTTTGG + Intergenic
1045857212 8:106778365-106778387 AAAAGTTTTCATGTTGAGTTGGG + Intergenic
1047620332 8:126600022-126600044 AAAAGTTTTCTGTAGAGGTTAGG + Intergenic
1049524249 8:143113310-143113332 AAAAGTACTCTTGTCTAGTTTGG - Intergenic
1050228687 9:3492809-3492831 AAGCTGTTTCTGGTCAAGTTAGG + Intronic
1051982320 9:23036430-23036452 AAAAGTTTTCTTGCTATGTTTGG - Intergenic
1054903623 9:70395009-70395031 CAAAATTTTCTTGGCAAGTTGGG - Intronic
1054937255 9:70701095-70701117 ATAAATTTTCTAGTCAAGTATGG + Intronic
1055151009 9:72999702-72999724 AAAAGTTTTTTGGTATATTTTGG + Intronic
1055934384 9:81591175-81591197 AAGAGTTCTCTAGTCAAGATTGG + Intronic
1055951296 9:81732247-81732269 AAAAATTTTCTGGCCACGTACGG - Intergenic
1056129875 9:83573859-83573881 AAAGGGATTTTGGTCAAGTTTGG + Intergenic
1056599452 9:88035388-88035410 AAAAGTTTTCTGTCAAAGCTGGG - Intergenic
1057107601 9:92434749-92434771 AAAAGTTTTCTGGGCAAGATGGG + Intronic
1057892983 9:98883367-98883389 AAAAGTTTTCTGGAAAATTCTGG - Intergenic
1058888337 9:109339981-109340003 AAAAATTTTCTGGCCAAGAGTGG - Intergenic
1060158172 9:121334851-121334873 AAAAGTTCCCTGGGCAATTTGGG - Intergenic
1061538537 9:131264698-131264720 AAAAGGCTTCAGGTCAAATTAGG - Intronic
1203393271 Un_KI270509v1:1927-1949 AAAAGCTTTGTGGTCTATTTTGG - Intergenic
1203404442 Un_KI270515v1:4811-4833 AAAAGCTTTGTGGTCTAATTTGG + Intergenic
1203396622 Un_KI270519v1:22241-22263 AAAAGCTTTGTGGTCTATTTTGG + Intergenic
1185967792 X:4627281-4627303 AAAAATTTACTGATCTAGTTTGG - Intergenic
1188223846 X:27573059-27573081 AAAATTTTTTTTTTCAAGTTGGG - Intergenic
1188755937 X:33963662-33963684 AAAGGTTTTCTGTTTAAGCTGGG + Intergenic
1189518288 X:41738263-41738285 AAAAGTATTCTGGCCAAGCCCGG - Intronic
1189611673 X:42743143-42743165 ATAAGTTTTCTGATCATATTGGG + Intergenic
1189660369 X:43290721-43290743 AAAAAATTTATGGTGAAGTTTGG - Intergenic
1190096818 X:47488118-47488140 TAAAGTTTTCTGGCAAATTTTGG + Intergenic
1194754447 X:97721278-97721300 CAAAGTTTTCTTCTCAACTTTGG - Intergenic
1194832165 X:98636735-98636757 AATAGTTTTCAGTTCAGGTTGGG + Intergenic
1195743138 X:108086909-108086931 AAAAGTTTTCTGTACAAAGTTGG + Intronic
1195951115 X:110274211-110274233 AAATGTATTCTGGTAATGTTAGG + Intronic
1198558890 X:137826644-137826666 AAAACGTTTCTGATCAAGTCTGG + Intergenic
1199203502 X:145121021-145121043 AAAAGTTATCTTGGAAAGTTAGG + Intergenic
1199664333 X:150084425-150084447 AAAGGCTTTCTGGTCAAGGTAGG + Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1200822393 Y:7600184-7600206 AAAATTTTTATGGACAAGTGAGG - Intergenic
1201786686 Y:17790659-17790681 AAAAGTTTTCATGTGAAATTTGG + Intergenic
1201814867 Y:18115329-18115351 AAAAGTTTTCATGTGAAATTTGG - Intergenic
1202237909 Y:22733833-22733855 AAAATTTTTATGGACAAGTGAGG + Intergenic