ID: 988445344

View in Genome Browser
Species Human (GRCh38)
Location 5:31280130-31280152
Sequence CTGAAGAAGGGGAAGGTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 400}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988445335_988445344 18 Left 988445335 5:31280089-31280111 CCATTGAAATCTTGACTGCCACG 0: 1
1: 0
2: 0
3: 3
4: 85
Right 988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG 0: 1
1: 0
2: 4
3: 38
4: 400
988445336_988445344 0 Left 988445336 5:31280107-31280129 CCACGCAAACCAGCAATTAACAC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG 0: 1
1: 0
2: 4
3: 38
4: 400
988445337_988445344 -9 Left 988445337 5:31280116-31280138 CCAGCAATTAACACCTGAAGAAG 0: 1
1: 0
2: 0
3: 13
4: 155
Right 988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG 0: 1
1: 0
2: 4
3: 38
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988445344 Original CRISPR CTGAAGAAGGGGAAGGTGTA GGG Intronic
900207212 1:1436647-1436669 GTGAGGAATGGGAAGGTGTGGGG + Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902483755 1:16727794-16727816 CCAAAGAAAGGGAAGGTGTGTGG + Intergenic
902808793 1:18876575-18876597 CTGAAACAGGGGCAGGGGTAGGG + Intronic
902814395 1:18907960-18907982 CTGAAGGAGAGAAAGGTGGAAGG - Exonic
902928445 1:19713392-19713414 AGGAAGAAGGGGAAGGGGTGGGG + Intronic
902992977 1:20202583-20202605 TTGGAGAAGGGGAAGGAGAATGG - Intergenic
903103126 1:21050943-21050965 CTGAATAAGGGGATGGGGTAGGG + Exonic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903790439 1:25889436-25889458 CTGGAGAAGGAGTAGGTGTGGGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904497094 1:30893144-30893166 CTGAGGGTGGGGAAGGTGCAGGG + Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905168019 1:36094516-36094538 CTGAAGAAGGGAAAATTGAAAGG + Intergenic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
905633008 1:39529418-39529440 CTGAGGAAGTGGCAGGTGTGCGG + Intergenic
908543874 1:65146663-65146685 CTGCAGAATGCAAAGGTGTACGG + Intergenic
908855539 1:68422894-68422916 CAGAAGTAGGGGAAGCTGTTAGG - Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
910099628 1:83562259-83562281 TTGAAGAAGGGGATGAGGTAGGG - Intergenic
910342336 1:86202429-86202451 CTGAAGAGGTTGAAGATGTAAGG - Intergenic
910880665 1:91919791-91919813 CTGAGGAAGGGAAAGGTGGTTGG - Intergenic
911468727 1:98288679-98288701 CTGAAGAAGAGGAAGTGATAAGG + Intergenic
911692568 1:100850923-100850945 CTGATGAGGGGGAAGCAGTAGGG + Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
912258616 1:108086220-108086242 CTGAAGAAGGGGTAGGGATAAGG + Intergenic
914912465 1:151798959-151798981 CTAAAGAAGGGGAAGTTGCTGGG + Intergenic
915147957 1:153806490-153806512 CTGGGGAAGGGGAGGGGGTAGGG - Exonic
917050127 1:170913535-170913557 GTGAAGGAGGAGAAGCTGTAGGG - Intergenic
917719979 1:177778085-177778107 CTGTGGAAGAGGAATGTGTATGG - Intergenic
917797387 1:178542108-178542130 GAGGAGAAGGGGAAGGTGTCAGG - Intronic
918015820 1:180631942-180631964 CTGACGAAGGGGGTGCTGTAAGG - Intergenic
919708672 1:200704511-200704533 CTGAGGAAGGGGAAGACATAAGG - Intergenic
920596841 1:207280240-207280262 CTGAAGAAGGGGATGAAGGAGGG + Intergenic
921636430 1:217500278-217500300 CTGAAGAGGAGGGAGGAGTAAGG - Intronic
921916904 1:220623427-220623449 CTTAAGAAAGGGAAGATGTGGGG - Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1065328665 10:24571636-24571658 CTGCAGAAGGTGGAGGTGGAAGG - Intergenic
1065514803 10:26514651-26514673 CTGTAAAAGGGAAAGGTGTCTGG - Intronic
1067061503 10:43080268-43080290 CTGCAGAGGGGGAAGGTCTCAGG - Intronic
1067062463 10:43084847-43084869 TGGAGGAAGGGGAAGGTGCAAGG + Intronic
1067713622 10:48670788-48670810 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1068564620 10:58559682-58559704 CTGAACAAGGGAAATGTGAAAGG - Intronic
1069607103 10:69746455-69746477 CGGAAGAAGGGTAAAGTGAAAGG + Intergenic
1070844158 10:79508151-79508173 CTGGAGGAGGGAAAGGTGCAAGG - Intergenic
1070929639 10:80252160-80252182 CTGGAGGAGGGAAAGGTGCAAGG + Intergenic
1071792747 10:88973147-88973169 CAGAAGAAAGGGAAGGTGAGAGG - Intronic
1072501669 10:96024003-96024025 CTGAGGAAGAGGCAGCTGTAGGG - Intronic
1072686445 10:97540046-97540068 CTGAGGAAGGGGGAGGGGCATGG + Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074105060 10:110383155-110383177 CTGGAGATGGGGAATGTGTCAGG + Intergenic
1074124056 10:110514269-110514291 CTGGAGAAGGGGATTGTGTGGGG - Intergenic
1074813600 10:117127968-117127990 CTGAGGAAGGGGAACGTGATTGG - Intergenic
1074924447 10:118053184-118053206 GAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1075011559 10:118874733-118874755 CTGAAACAGGGGAATGTGGATGG + Intergenic
1075363777 10:121864232-121864254 GGGGAGAAGGGGAAGGTATAGGG + Intronic
1076338663 10:129727965-129727987 CTGGAGCAGGGGAGGGTGTGAGG + Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1079081556 11:17416876-17416898 CTCAACAAAGGGAAGGGGTAGGG - Intronic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1079996668 11:27302562-27302584 GTGAAGAAGAACAAGGTGTAGGG - Intergenic
1080694862 11:34594693-34594715 CTGAGGCAGGGGTAGGGGTAGGG - Intergenic
1081123042 11:39289815-39289837 TTGAAGAAAGGGAATGTGTGGGG - Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1082196797 11:49316251-49316273 AAGGAGAAGGGGAAGGGGTAAGG + Intergenic
1083248848 11:61451816-61451838 CTGAAGAAGGGATAAGTGAATGG + Intronic
1083443134 11:62690021-62690043 CAGAGGAGGGGGATGGTGTAGGG - Intergenic
1083679027 11:64342850-64342872 CAGAGGATGGGGCAGGTGTAGGG + Intronic
1083882343 11:65554824-65554846 CTGAAGGAGGGAAGGGTTTATGG - Intronic
1084147163 11:67271152-67271174 AGGAAGAAGGGGCAGGTGTGAGG - Intronic
1085715909 11:78873091-78873113 CTGGAGACTGGGAAGCTGTAGGG - Intronic
1085983131 11:81748880-81748902 ATGAAGAAGGAGAAGGAGAAGGG - Intergenic
1086132946 11:83420112-83420134 GTGGAGAAGGGGTAGGTATATGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1088079311 11:105891511-105891533 CTGAAGAAGGGATAGTTGTGGGG - Intronic
1088709157 11:112491175-112491197 CAGAAGAGGGGGAATGGGTAGGG + Intergenic
1089163521 11:116457672-116457694 CTGAGGAAGGGGAAGAGGCAGGG + Intergenic
1089271094 11:117301752-117301774 GTGAAGAAGAGGAAGGTGTTAGG - Intronic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090235354 11:125142824-125142846 ATGGACAAGGGGAAGGAGTAAGG + Intergenic
1091947542 12:4561916-4561938 TTGAAGAAGGGGAGAGAGTAGGG + Intergenic
1093908986 12:24724555-24724577 CTGAAGTATGGGATGATGTATGG - Intergenic
1095797047 12:46231288-46231310 CCAAAGAAGGGGAAGGTGGGAGG + Intronic
1095878673 12:47108414-47108436 CTGAACAACAGGAACGTGTAGGG - Intronic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1097539119 12:60914109-60914131 CTGAAGGTGGGGCAGGTGTGGGG - Intergenic
1098040776 12:66352301-66352323 CTGAAGTAGAGGAAGGAGCAGGG + Intronic
1098073546 12:66701233-66701255 ATGAAGAGGAGGAAGGGGTAAGG - Intronic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099748090 12:86733357-86733379 CTTAAGAAGGGGAAGGCACAAGG + Intronic
1100465917 12:94845202-94845224 CTGAAGACGGAGAAGGGATACGG - Intergenic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102654120 12:114466002-114466024 CTGATGAAGAGCAAGGTGTGTGG - Intergenic
1103086649 12:118066620-118066642 CTGAAGAAGAGGATGGTCCATGG - Exonic
1103269321 12:119659320-119659342 ATGATGTAGGAGAAGGTGTAAGG + Intergenic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1103996780 12:124835150-124835172 GTGGAAAAGGGGAAAGTGTATGG + Intronic
1105210821 13:18255771-18255793 CTGCAGAAGGGGCAGGTTTGGGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105950976 13:25229345-25229367 GTCAAGTAGGGGAAGGAGTAGGG - Intergenic
1106684964 13:32049029-32049051 TTGATGAAAGGGAAGGTGTAAGG + Intronic
1108102533 13:46972177-46972199 CTGAAGAAGCATAATGTGTAAGG - Intergenic
1108437346 13:50413665-50413687 GGAAAGAAGGGGAAGGTGGAGGG + Intronic
1108701709 13:52949458-52949480 CTGGAGATGGGGAAGGGTTATGG + Intergenic
1110721641 13:78768646-78768668 CTGAAGAAGGGGAATGGGAGTGG + Intergenic
1111127840 13:83935342-83935364 CTGAAGAAGGGCATGGAGGAAGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1112979176 13:105360082-105360104 CTGAAGACGGGGACAGTATAAGG + Intergenic
1115120317 14:29929088-29929110 CAGAGGAAGGGGAAAGTCTAGGG - Intronic
1116256927 14:42569096-42569118 CTGTAAAATGGGAAGGTCTATGG - Intergenic
1116720425 14:48488842-48488864 CTGAATAAGTGAAAGGTGAAGGG + Intergenic
1118723412 14:68609751-68609773 CTGGAGAAGAGGAAGGTGAAAGG - Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1122059022 14:99124412-99124434 GTGGAGAAGGGGAAGGTGCATGG - Intergenic
1127446393 15:59067355-59067377 AGGAAGAAGGGGAAGGGGAAGGG - Intronic
1127540273 15:59930837-59930859 GTGAAGATGGAGAAGGTGCAGGG - Intergenic
1127827244 15:62715529-62715551 CTGAAGCAGGGGAAGGCTAATGG - Intronic
1128801785 15:70501685-70501707 CTGATCAAGGGGAAGGGGTTGGG + Intergenic
1128806416 15:70534332-70534354 AAGAAGAAGAGGAAGGTGAAGGG + Intergenic
1128891045 15:71332025-71332047 AAGAAGAAGGGGCAGTTGTAGGG + Intronic
1130542724 15:84833484-84833506 CTGGAGAGGTGGAAGGTGGATGG + Intronic
1131206467 15:90452598-90452620 CTGAAGAAGGGTGAACTGTACGG - Intronic
1131621438 15:94072295-94072317 ATGAGGAAGTGGAAGGTGTTGGG - Intergenic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134596575 16:15500527-15500549 TTGAGGAAGGGGAAGGTATCAGG + Intronic
1135963429 16:27016463-27016485 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1136116064 16:28095562-28095584 CTGAGGAAGGGGATGGGGAAAGG - Intergenic
1137374556 16:47941598-47941620 TTGCAGAAGAGGAAGGAGTAGGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137552208 16:49445367-49445389 TGGAAGAAGGAGAAGGTGTCAGG - Intergenic
1138262875 16:55637972-55637994 CTGAAAAACGGGAAGGGGAATGG + Intergenic
1139060940 16:63250684-63250706 AAGAAGAAGGGGAAGGCGGAGGG + Intergenic
1139179744 16:64732467-64732489 ATGAAGATGGAGAAGGTGAAGGG - Intergenic
1140024101 16:71267886-71267908 CTGCATAAGGAGAAAGTGTAAGG + Intergenic
1140594682 16:76395021-76395043 CTGAAAAAGAGGAATGTTTAAGG - Intronic
1143206698 17:5146386-5146408 TTGAAGAAGGGAAATATGTAAGG + Intronic
1144014128 17:11177704-11177726 GTGATAAAGGGAAAGGTGTAGGG + Intergenic
1145414733 17:22705114-22705136 CTGAAGAAGAGGAAGATGACTGG + Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146620343 17:34392143-34392165 CTGAATAAGGTGCAGGAGTAGGG - Intergenic
1146926593 17:36750003-36750025 CTGAAGAAGGGCGAGGTGCCTGG - Intergenic
1147335233 17:39723610-39723632 CTGAGGAAGGTGAAGGTGCTTGG + Exonic
1147637364 17:41972269-41972291 CTGCAGAAGGCGAAGGTGCTTGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149514715 17:57271847-57271869 CTGAAGGAGGGGAAAGAGTGAGG + Intronic
1150087487 17:62285081-62285103 TTGAAGAAGGGAAATATGTAAGG - Intergenic
1150247794 17:63689264-63689286 CTGGCCAAAGGGAAGGTGTATGG - Intronic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1150769027 17:68025734-68025756 TTGGAGAAGGGGTAGATGTATGG + Intergenic
1150815559 17:68389605-68389627 CTGAAGAAGAGGAAGGGACAGGG - Intronic
1151125149 17:71836813-71836835 CTCAAGAAGGGGTGGGTGCAGGG + Intergenic
1152235586 17:79136640-79136662 CAGAAGATGGGGAAGGTGCTGGG + Intronic
1152648695 17:81482107-81482129 CTGAAGCGGGGGACGGTTTAGGG - Intergenic
1153095745 18:1400819-1400841 TTGAAGTAGGGATAGGTGTAGGG + Intergenic
1156442574 18:37206292-37206314 CTGAGGAAGAGGACGGTTTAAGG + Intronic
1157089999 18:44625855-44625877 GTGAAGAAGGGGAAGCTGTGAGG + Intergenic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1159902798 18:74063791-74063813 TTGAAGAAGCGGAAGGTGACAGG - Intergenic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1160501877 18:79405602-79405624 TAGAAGAAGGGCAAGGTGTGGGG - Intronic
1163235663 19:16029099-16029121 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
1163320759 19:16573149-16573171 CTGCAGAAGGGGGAGGTGCCGGG + Intronic
1163672346 19:18636625-18636647 CTGAAGAAGGGGCAGGCCCAGGG - Intergenic
1164423291 19:28116802-28116824 CTGAACAAGTGGAAGGGGCAGGG - Intergenic
1165137638 19:33679940-33679962 CTGAGTAAGGGGGAGGTGTAAGG + Intronic
1165144801 19:33724313-33724335 GTGCAGAAGGGGAAGGTGCTGGG + Intronic
1165221455 19:34320073-34320095 CTGAAGTAGAGGAAGCTGTGCGG + Exonic
1165641495 19:37391774-37391796 ATGAGGAAGATGAAGGTGTAGGG + Intronic
1165913541 19:39244331-39244353 ATGGAGAAGGAGAAGGTGAAGGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166531071 19:43543896-43543918 CAGAAGCAGGGGTAGGGGTAGGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
925203719 2:1989430-1989452 CTGCAGAATGAGAAGATGTAGGG - Intronic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
926081802 2:9993223-9993245 CTGAAGAATTGGAGGGTGAAGGG + Exonic
927269899 2:21195429-21195451 CTGAAGAAAGGGAAGAAGGAAGG - Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930017167 2:46978897-46978919 CTGAAGAAGGGGTAGGTCACTGG + Exonic
930140914 2:47950587-47950609 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
930614524 2:53579486-53579508 CTGAAGCTGGGGATGGGGTAGGG - Intronic
931069983 2:58635622-58635644 TTGAAGGAGGCGAAGGTGTCAGG + Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
933017407 2:77145988-77146010 CTGAAGCAGGTGGAGGTCTATGG - Intronic
933208101 2:79532997-79533019 CTGAAGAAGAGCCAGGGGTATGG - Intronic
933665248 2:84959577-84959599 CTGAAGAAGGAGACAGTGTATGG - Intergenic
933730392 2:85451890-85451912 CTGCAGAAGGAGCAGGTCTAGGG - Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
936478971 2:112867794-112867816 ATGAAGAAGGAGATGGTATAGGG + Intergenic
936764296 2:115827024-115827046 CAGAAGAAATGGAAAGTGTATGG - Intronic
937284862 2:120743882-120743904 CTGGAGAAAGGGAAGGTCTTGGG + Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
938034641 2:128026868-128026890 GGGAAGATGGAGAAGGTGTAGGG - Intronic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
939202992 2:139062665-139062687 CTGAAGAAGGGGAAGTCTTCTGG - Intergenic
939481528 2:142753989-142754011 ATGGAGAAGGGAAAGGTGTGAGG + Intergenic
940006869 2:149016324-149016346 CTGAAGAAGGGGTAGGAATGGGG + Intronic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
940345455 2:152623733-152623755 CTGACGAAGCTGAATGTGTATGG + Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941234021 2:162946623-162946645 GGGAAGAAGGGGAAGGAGAAGGG + Intergenic
942604655 2:177677600-177677622 TTGAAGAAGGAGAGGGTGGAAGG + Intronic
942650660 2:178163922-178163944 GTGAAGAAGGGGGAGGAGTTGGG - Intergenic
943271969 2:185817012-185817034 GTGAAGAAAGGGAAGGAGCAAGG + Intronic
943876307 2:193071915-193071937 CAGAAGAAGGGAAAGGCGGAAGG - Intergenic
945022877 2:205591791-205591813 CTGAAGAAAAGGAAGCTGTCCGG + Intronic
946175609 2:217920309-217920331 ATGAAGCAGGGGGAGGTGTGGGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946661794 2:222008683-222008705 CTGAATAAGGGGAGTGGGTATGG + Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947326181 2:228980089-228980111 CTGAAGAAGGTGCAGTTGTCAGG - Intronic
947813586 2:233021408-233021430 CTAAAGATGGGTAAAGTGTAAGG - Intergenic
948496043 2:238350606-238350628 CTGATGAAGGGGAGGGGTTAGGG + Intronic
948644447 2:239395061-239395083 CTGGAGAAGAGGAAGGTAAAGGG + Intronic
948667486 2:239545664-239545686 CTGAGGGAGGGGAAAGTGTGAGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948702449 2:239768747-239768769 CTGATGGGGGGAAAGGTGTATGG + Intronic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948935056 2:241158535-241158557 CTGAAGAAAGTGAAGGTGAGAGG + Exonic
948948288 2:241232980-241233002 AGGAAGAAGGGGAAGGGGAAGGG + Intronic
949036046 2:241816176-241816198 CTGTAGAAGGCGAAGGAGTGAGG - Exonic
1168760085 20:344627-344649 CTGTAGAAGGCGAAGGGGAAGGG - Intergenic
1169416970 20:5425676-5425698 CTGAAGTATGGGAAAGAGTAGGG + Intergenic
1170254989 20:14331776-14331798 CTCAGAAAGGGGAAGGTCTAAGG - Intronic
1170532640 20:17309853-17309875 AAGAAGAAGGGGAAGGGGAAGGG + Intronic
1171291960 20:23987460-23987482 CTGCAGAAGGGGCAGGTTTGGGG + Intronic
1171416738 20:24986608-24986630 CTGCAGCAGGGAAAGGAGTAAGG + Intronic
1172012102 20:31851519-31851541 CTGAAGATGGTGGAGGTGAAGGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172897671 20:38311991-38312013 CCGTAGAAGGGGGAGGTGTGTGG - Intronic
1173112253 20:40202979-40203001 ATGAAGGAGGGGAAGGGGAAGGG + Intergenic
1174198516 20:48790642-48790664 GAGAAGAAAGGGAAGGTGAAGGG + Intronic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174733666 20:52943010-52943032 TTGGAGAAGGGGAAGGTATTAGG - Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175466308 20:59192868-59192890 CAGGAGAAGTGGCAGGTGTACGG + Exonic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1176032006 20:63017267-63017289 CTGAAGAAGGGGGTGGTGCCTGG + Intergenic
1176198892 20:63850991-63851013 CTGAAGTAGGGGGAAGTGGAGGG - Intergenic
1176283522 20:64328524-64328546 CTGGAGGAGAGGAAGGTGTGGGG + Intergenic
1176720418 21:10388133-10388155 AGGAAGAAGGGGAAGGGGAAGGG + Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1179030704 21:37717416-37717438 CTGGAGATGGGGTGGGTGTATGG + Intronic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180956688 22:19744430-19744452 CTGGTGGAGGGGAAGGTGAAGGG - Intergenic
1181331397 22:22094868-22094890 GGGAAGAAGGGGAAGGGGCAAGG + Intergenic
1181399984 22:22645475-22645497 CTGCAGAAGGGGCAGGTTTGAGG - Intronic
1181701957 22:24626573-24626595 CTGCAGAAGGGGCAGGTTTGGGG - Intronic
1183361954 22:37387455-37387477 CTACAGAGGGGGAAGGTGTCAGG - Intronic
1183848406 22:40562593-40562615 GGGAAGGAGGGGAAGGGGTAAGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
950366400 3:12488149-12488171 CTGAGGGAGGGGAAGGTGAGTGG - Intronic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
952666634 3:35913521-35913543 CTGAAAAAGGTGAACGTGTAAGG - Intergenic
953450562 3:43001842-43001864 CAGGAGAAGGGGAAGGGGTGAGG - Intronic
954753202 3:52825089-52825111 CTGAAAAAGGGCAAGGTTTTGGG - Intronic
954802766 3:53196661-53196683 CCGAGGAAGGGGCAGGTGCATGG - Intergenic
956368195 3:68529235-68529257 GTGAAGAAGGGCAGGGTGGAGGG - Intronic
956376844 3:68622243-68622265 CTGAAGAAGGAGTATGTGAATGG - Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957564280 3:81865073-81865095 GTGAGGAAGGGGAAGGGGGAGGG - Intergenic
957931201 3:86880414-86880436 CTGAAAAAGGGGAATCTCTAAGG - Intergenic
958119887 3:89271906-89271928 CTGAAAAAGAGGAAGGGGAAGGG - Intronic
960316347 3:116182572-116182594 GTGAAGAAGGGGTAGATGAAAGG + Intronic
960580270 3:119272151-119272173 GTAAGGAAGGGTAAGGTGTAAGG - Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962655916 3:137543743-137543765 CTGAAGCAGGGCAAGGTGTCGGG + Intergenic
964394867 3:156234618-156234640 GTGAAGAATGGGAAGATGAAAGG + Intronic
965422745 3:168482184-168482206 CAAAAGAAGGGGAAGTTTTAGGG + Intergenic
965789792 3:172375094-172375116 CTTAAGAAGAGGAAAGGGTAGGG + Intronic
966930263 3:184671434-184671456 ATGAAGTAGGGTAAGGTGTGGGG + Intronic
966962451 3:184953827-184953849 TTGAAGGAGGGAAAGGTGTGTGG + Intronic
967096981 3:186185432-186185454 TTGAAGAAGGGGAAGATGTAAGG + Intronic
967133045 3:186490202-186490224 CTGGAGAATGGGATGGTGGAAGG + Intergenic
967315466 3:188148607-188148629 ATGAGGAAGGGGAAGCTGCAGGG + Intergenic
967546153 3:190731262-190731284 CTGAAGGAGGTGAGGCTGTAGGG + Intergenic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968481144 4:833569-833591 AGGAAGAGGGGGAAGGTGGAAGG + Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968805156 4:2767465-2767487 CTGAAGACAGGCAAGGGGTATGG - Intergenic
968917524 4:3503082-3503104 CTGACAAAAGGGAAGGTGAAAGG - Intergenic
970645298 4:18113832-18113854 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
971305114 4:25473289-25473311 ATGAAGAAGGAGAAGGAGAAGGG + Intergenic
971305153 4:25473376-25473398 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
974314092 4:60255153-60255175 CCGAAGAAGTGCAAGATGTACGG + Intergenic
975393554 4:73848662-73848684 GGGAAGGAGGTGAAGGTGTAGGG - Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
978268533 4:106858872-106858894 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
979717842 4:123863019-123863041 CTGAACAAGGGGAAAGTATGAGG - Intergenic
980768302 4:137336906-137336928 CAGAAGAAGGGAATGGTCTAAGG + Intergenic
981215352 4:142159273-142159295 GTGAAGAAGGTGAAGGTAAAAGG + Intronic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
982305367 4:153924820-153924842 CTGAAGCAGGGAAATGTGTTGGG - Intergenic
982364366 4:154559179-154559201 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
983573851 4:169238970-169238992 CTGAAAAAGGGCAAGGGGTGGGG - Intronic
984005351 4:174299189-174299211 CTGAAGAGGTGGACTGTGTAGGG + Exonic
984819337 4:183866510-183866532 ATGAAGAAGAGGATGGTGGAGGG + Intronic
984853707 4:184175258-184175280 CTGAAGCAGGGAGATGTGTATGG - Intronic
985034037 4:185820535-185820557 CTGCAGTTGGGGAAGGAGTAGGG + Intronic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986287264 5:6368984-6369006 TTGAACAAGTGGAAGATGTATGG + Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986746585 5:10750243-10750265 CTGATGAACGGGAAGGAGAATGG + Intronic
986946672 5:13029309-13029331 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
986946684 5:13029342-13029364 AAGAAGAAGGGGAAGGGGAAGGG + Intergenic
986946699 5:13029378-13029400 GGGAAGAAGGGGAAGGGGAAGGG + Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
989147350 5:38261932-38261954 CTGAAGAATGGGAGGGTTTAGGG + Intronic
989794326 5:45447792-45447814 CTCAAAAAGGGGGAGGTGTTTGG + Intronic
990320316 5:54623474-54623496 CTGAAACAGGGCAAGGTGGATGG + Intergenic
990662308 5:58029771-58029793 CTGGAGATGGGGAAGCTGTATGG + Intergenic
991027060 5:62041169-62041191 AAGAAGAAGGGGAAGAAGTAGGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
995655716 5:114423909-114423931 ATGGAGAAAGGGAAGGTGCAGGG + Intronic
997428196 5:133818748-133818770 GTGAGGCAGGGGAAGGTGTAGGG - Intergenic
997546045 5:134708783-134708805 CTGAAGAACGGTAAGCTGAAAGG - Exonic
997593798 5:135092695-135092717 GTGAGGAAGGAGAGGGTGTATGG - Intronic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
999442110 5:151610082-151610104 CTGAGGAGGAGGAAGGTGGAAGG + Intergenic
999827397 5:155287145-155287167 CTGAAGAGATGGAAGGGGTAAGG + Intergenic
1001223064 5:169919585-169919607 TTGAAGAAGTGGTAAGTGTATGG + Intronic
1001290529 5:170455296-170455318 AAGAAGAAGGGGAAGGGGAAGGG - Intronic
1001586527 5:172836604-172836626 CTGAAGCGGAGGAAGGTGCATGG - Intronic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1001776961 5:174336347-174336369 CCAAAGCTGGGGAAGGTGTATGG - Intergenic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002260505 5:177990863-177990885 CAGAAGCAGGGCAAGGGGTAGGG - Intergenic
1003899744 6:10643341-10643363 ATGGAGAAGGGGAAGGTCAAGGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1005742590 6:28806275-28806297 CTGTTGAAAGGGAAGGTCTAGGG - Intergenic
1005835753 6:29708078-29708100 TTGAATAAGGGCAAGGTGTATGG - Intergenic
1006102310 6:31693150-31693172 CTGAGGAAGGGAAAGATGCAGGG + Intronic
1006483351 6:34316925-34316947 CTGAAGAAGGCAAGGGTGCAGGG + Intronic
1007725148 6:43911538-43911560 CTGAAGGAGAGGAATGTGTCTGG - Intergenic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1010389670 6:75322389-75322411 TTGAAGAATGGGAAGGTGAGCGG - Intronic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1012997097 6:105984933-105984955 CTGAAGATGGGGCAGATATAGGG + Intergenic
1013067122 6:106694683-106694705 CTGAGGTAGGTGAAGGGGTAAGG - Intergenic
1013301420 6:108808474-108808496 CTGGAGAAGGGGGTGGTGCATGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015082517 6:129245025-129245047 CTGAAGAACAGGAAAGTGAATGG + Intronic
1015389705 6:132667827-132667849 CTGAAGAAAGGGGAGGTGGAAGG - Intergenic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1016671210 6:146710781-146710803 CTGAAAAATGAGGAGGTGTAGGG - Intronic
1017056678 6:150443096-150443118 TAGATGAAGGGGAAGGAGTACGG - Intergenic
1017352629 6:153459643-153459665 CTGAGGAAGGGGTAAGTGAAGGG - Intergenic
1017742516 6:157419455-157419477 CAGAGGATGGGGAGGGTGTATGG - Intronic
1017950838 6:159133317-159133339 CTGGAGAAAATGAAGGTGTAAGG - Intergenic
1018144870 6:160876801-160876823 CTGAGGAAGGGGTAAGTGAAAGG + Intergenic
1018207603 6:161450173-161450195 GTGAAGAGGGGGAAGGTGTATGG + Intronic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1020492312 7:8802517-8802539 CAGAAGAAGTGAAAGGGGTAGGG + Intergenic
1021054129 7:16026140-16026162 TTGAAAAAGTTGAAGGTGTAAGG - Intergenic
1021422122 7:20457522-20457544 CTGAATGAGGGGAATCTGTATGG - Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1023530107 7:41144197-41144219 GTGATGAAAGGGAAGGAGTATGG - Intergenic
1023862611 7:44225314-44225336 CTGTAGAAGTGGCAGGTGTCGGG + Intronic
1024042693 7:45567562-45567584 AGGAATGAGGGGAAGGTGTATGG + Intergenic
1024292646 7:47816028-47816050 CTGAAGGGTGGGAAGGTGTCGGG + Intronic
1025790007 7:64680373-64680395 CTGAAGAATGGGAGGGTGTTTGG + Intronic
1027195052 7:76024242-76024264 CTCAAAAAGGGGGAGGTGTTGGG + Intronic
1029851342 7:103464698-103464720 CTGAAGAAGGCCCAGGTGGATGG + Intergenic
1031214795 7:118877087-118877109 GGGAAGAAGGGGAAGGGGAAGGG + Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032691750 7:134294394-134294416 CTGAAGAAGGAAAAGGTGATGGG + Exonic
1033041561 7:137923944-137923966 CTGGAGAAGGGCAAGGACTAGGG - Intronic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1034417017 7:150970607-150970629 CTAGAGAAGGGAAAGGTGGAGGG + Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035488907 7:159254916-159254938 GTGAAGATGGGGCAGGGGTAGGG + Intergenic
1037570143 8:20150913-20150935 CTGAAGAAAGGAGAGGTGTGGGG - Intronic
1037908073 8:22727189-22727211 CTGAAGAAAGGGAAGATTCAGGG - Exonic
1038042640 8:23737997-23738019 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041599166 8:59695214-59695236 CTGAAAATGGGTAAGGTGGAAGG + Intergenic
1042025259 8:64416137-64416159 CTGAAGAGGGGGAAGAAATAGGG - Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1042598731 8:70476953-70476975 CTAAAGAAGGAGAACCTGTATGG + Intergenic
1043756429 8:84009530-84009552 CAGAAGCAGGGGAAGGGGTAGGG + Intergenic
1044402237 8:91786161-91786183 GGGAAGAAGGGGAAGGAGAAGGG - Intergenic
1044472777 8:92590032-92590054 CAGAGGGAGGGGAGGGTGTATGG - Intergenic
1044782016 8:95752856-95752878 ATGGATAAGGGGAAGGTGTTGGG - Intergenic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1046807384 8:118494608-118494630 GTGAATAAGAGGAAGGTGTTTGG - Intronic
1047557174 8:125944931-125944953 ATGAGAAAGGGGAAAGTGTAGGG + Intergenic
1050195409 9:3078030-3078052 CTCAAAACGGGGAAGGTGGAAGG - Intergenic
1050214620 9:3308799-3308821 AAGAAAGAGGGGAAGGTGTATGG + Intronic
1050291586 9:4160998-4161020 CTTAAGAAGGCTAAGGTGGAAGG + Intronic
1051109483 9:13619577-13619599 AGGAAGAAGGGGAAGGGGCATGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1054883954 9:70175451-70175473 CTGAAAAATGGCAAAGTGTAAGG + Intronic
1055720071 9:79163496-79163518 CTGAAGCAGGAGAAGGTTTGAGG - Intergenic
1057506714 9:95640070-95640092 CTCAAGAATGGGAAGGAGTCAGG + Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059754351 9:117278520-117278542 ATGAAGAGGGGGAAGGGGTTAGG - Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1059846846 9:118289327-118289349 CTGCAGAAGGGGTAGATTTACGG + Intergenic
1060551822 9:124489238-124489260 CTTAAGGAGGGGTAGGTGGAGGG - Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061670348 9:132184993-132185015 CTTAAGAAGGGGAAGGCGCTGGG + Intronic
1186264634 X:7818805-7818827 AAGGAGAAGGGGAAGGAGTAGGG + Intergenic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1189861117 X:45273529-45273551 ATGAAGAATGGGCAGGTATATGG + Intergenic
1192116955 X:68420700-68420722 ATGAAGTAGGGGAAGGTTCAGGG - Intronic
1192269646 X:69566673-69566695 CTGGAGAAGGGGCAGGTGTAGGG + Intergenic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193679996 X:84506861-84506883 TTTTAGAAGGGCAAGGTGTAAGG - Intergenic
1195901190 X:109799115-109799137 CTCTAGAAGGGGAAGGAGTAGGG - Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196727057 X:118905257-118905279 AAGAAGAAGGGGAAGGGGAAGGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1197516715 X:127441142-127441164 CTGGAGAAGGGGAACAAGTAAGG - Intergenic
1198370152 X:135982372-135982394 CTGAAGATGGTGGAGGTGGAGGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1200062381 X:153489313-153489335 CTGAAGGAGGGGCAGGTGCAGGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic