ID: 988448539

View in Genome Browser
Species Human (GRCh38)
Location 5:31315556-31315578
Sequence TTAATTCCAAATGAACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988448536_988448539 28 Left 988448536 5:31315505-31315527 CCAAAATACTTCATTTATCTCAG 0: 1
1: 0
2: 3
3: 43
4: 392
Right 988448539 5:31315556-31315578 TTAATTCCAAATGAACAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988448539 Original CRISPR TTAATTCCAAATGAACAGCC TGG Intronic
904013769 1:27405285-27405307 TACATTCCAAAGGAGCAGCCTGG - Exonic
904402831 1:30267973-30267995 GAAATTCCAAATCAATAGCCTGG + Intergenic
904798808 1:33078440-33078462 TAGATTCCAAATGGACAGACTGG + Intronic
905927601 1:41762947-41762969 TTAATTTCACATGTGCAGCCAGG + Intronic
905974559 1:42165166-42165188 TTCATGCCAAAGGGACAGCCAGG + Intergenic
908133566 1:61102795-61102817 TTAATTCCAAATTTAAAGACAGG - Intronic
909541179 1:76793234-76793256 TTATTTCCAAATCTACAGGCAGG + Intergenic
915689737 1:157676850-157676872 GTAATTCCAAATCAGCAGCAGGG + Exonic
918026248 1:180750427-180750449 TTATTTCCAAAAGAATAGCATGG + Intronic
918085690 1:181243379-181243401 TGAAATCCAAAGGAACATCCAGG - Intergenic
920674656 1:208030660-208030682 TTGATTCCCAAATAACAGCCTGG + Intronic
924268148 1:242303713-242303735 TTGTTTCCAAACGAAGAGCCAGG + Intronic
1064559213 10:16579143-16579165 CTAGTTCCAAATGAACAGAATGG + Intergenic
1066569727 10:36757782-36757804 TAAATTCCAGATGAACAGAAAGG + Intergenic
1066716757 10:38295028-38295050 TTATTTCCAAACAAAGAGCCAGG - Intergenic
1068701687 10:60026622-60026644 ATGATACCAAATGAACAGCGAGG + Exonic
1071045006 10:81362464-81362486 TTCATTCCAAAAGAACACCAAGG - Intergenic
1073721792 10:106181249-106181271 TAAAATACAAATGAATAGCCAGG + Intergenic
1073761504 10:106633569-106633591 TTAATTCAAAATGATCACTCTGG + Intronic
1074835396 10:117287474-117287496 TTAGTCCCAAAGGAACATCCAGG - Intronic
1075377681 10:121992251-121992273 TTTCTTCCAAAAGAACAGCCTGG - Intronic
1079190649 11:18274206-18274228 TTAATTGCAGATGCACTGCCAGG - Intergenic
1080981961 11:37418415-37418437 TTTATTCCAAATAAACAGCCAGG - Intergenic
1081169115 11:39845274-39845296 TTAATTTCAAATTAAGAGTCAGG - Intergenic
1082125591 11:48428134-48428156 TGAAGATCAAATGAACAGCCTGG - Intergenic
1082559209 11:54599167-54599189 TGAAGATCAAATGAACAGCCCGG - Intergenic
1084796217 11:71506117-71506139 TTAATTCAAAATTGGCAGCCTGG - Intronic
1088980716 11:114860667-114860689 TTAAGTCCAGATGAACAGAGAGG - Intergenic
1089392345 11:118110814-118110836 TCACTTCCTAATGTACAGCCAGG + Intronic
1089566010 11:119372234-119372256 TTATGTCCAAATGTAAAGCCAGG + Intronic
1091477754 12:793487-793509 ATTATTCCAAATGAAAAGACAGG + Intronic
1092329216 12:7567212-7567234 TAAATTCCAAAGGGACAACCTGG - Intergenic
1093830759 12:23754572-23754594 GTAATTCCAAATGATCTGCATGG + Intronic
1099615327 12:84927100-84927122 AAAGTTACAAATGAACAGCCAGG - Intergenic
1100232029 12:92618425-92618447 TCTAAGCCAAATGAACAGCCAGG - Intergenic
1100542356 12:95569540-95569562 GTAATTGTAAATGGACAGCCTGG - Intergenic
1101397246 12:104359277-104359299 TTAATGCCAAATGATGAGCTAGG + Intergenic
1103397098 12:120616460-120616482 TTATTTAAAAATGAACAGCCAGG + Intergenic
1104054340 12:125217763-125217785 TTAATTCTAAATGCACTGACAGG + Intronic
1106505018 13:30363696-30363718 TTAATTCCAAAGACACAGCATGG - Intergenic
1107127642 13:36861973-36861995 TTAATCTCAATAGAACAGCCAGG + Intronic
1107306627 13:39027656-39027678 TTAAATACAACTGAACTGCCAGG + Intronic
1107873565 13:44769050-44769072 TCACTTCCAAACGACCAGCCTGG + Intergenic
1108020745 13:46125343-46125365 TTAATGCAGAATGAACGGCCAGG - Intergenic
1109070046 13:57753725-57753747 TTATTTGCAAAGGATCAGCCTGG + Intergenic
1110674599 13:78225929-78225951 TTGACCCCAAATGAACAGCTGGG + Intergenic
1110966636 13:81708048-81708070 TTAAAAACAAATGAACAGTCTGG - Intergenic
1112748759 13:102558289-102558311 TTTTTTCCAAATGAACTGTCAGG - Intergenic
1114273339 14:21118700-21118722 TTAGTTCTAAATGACCACCCAGG - Intergenic
1114714635 14:24812002-24812024 ATAATTCCAAGTAAACACCCTGG + Exonic
1116525357 14:45897349-45897371 TTAAGTCCAAGTGAACCTCCTGG - Intergenic
1117724439 14:58658869-58658891 AAAATTACAAATGAACTGCCTGG + Intergenic
1120077557 14:80176544-80176566 TTATTTCCATAGGAAGAGCCAGG - Intergenic
1122399041 14:101456730-101456752 TTAATTTCAAATAAACAGTCAGG + Intergenic
1128038771 15:64551212-64551234 TTAATTCAAAATGAACCAGCTGG - Intronic
1129859025 15:78846040-78846062 TTAAATCCAAATGAAAAGAGAGG - Intronic
1130444654 15:83989175-83989197 TTAAAAACAAATAAACAGCCAGG - Intronic
1131468638 15:92675921-92675943 TTAATTCAAAATAACCAGGCTGG + Intronic
1131730052 15:95269971-95269993 TTAATTCAACATTGACAGCCAGG - Intergenic
1134225811 16:12389213-12389235 TTAACTCCAATTTAACAGCCAGG - Intronic
1136093426 16:27936873-27936895 TTAATTCAAAATAAACGTCCAGG + Intronic
1139709527 16:68765159-68765181 TTAATTCCACATTCACAGCAAGG - Intronic
1140593245 16:76377865-76377887 TGAAATCCAAATGAACATTCTGG - Intronic
1144379396 17:14679198-14679220 TTAATTTCAAATGACCAGTCTGG - Intergenic
1147960605 17:44165301-44165323 AGAATTCCAAATAAACTGCCGGG - Intergenic
1148510605 17:48165905-48165927 TTCATTCCAAATGGACAGACTGG - Intronic
1148971023 17:51481728-51481750 TAAAGTCCAAATGAAAAGTCTGG - Intergenic
1150436817 17:65160358-65160380 TCAACCCCATATGAACAGCCAGG - Intronic
1151202321 17:72477709-72477731 CTGATTCCAACTGAGCAGCCGGG + Intergenic
1153626624 18:7027473-7027495 TTATTTCCAAATAAAGAGCTGGG + Intronic
1153809721 18:8741290-8741312 TTAATTCCACATGGACGGCAGGG - Intronic
1154051206 18:10960817-10960839 TTATTTCTAAATGAAGAGACTGG + Intronic
1155622301 18:27793729-27793751 TTAATCCCAATTGAAAAGCTAGG + Intergenic
1157827616 18:50826485-50826507 TAAATAACAAAAGAACAGCCAGG + Intergenic
1158688441 18:59637144-59637166 TAAATTCCAAATGTACTGCTGGG - Intronic
1158984621 18:62801336-62801358 TTAATTAGAAATTAGCAGCCAGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
925228516 2:2208020-2208042 TTAAATCCTAATGAACAGGAGGG - Intronic
927384611 2:22518568-22518590 TTAAGTCCAAACTAAAAGCCTGG + Intergenic
929486995 2:42363564-42363586 TTATCTCCCACTGAACAGCCTGG - Intronic
929909375 2:46075911-46075933 TGAAGTCCAGGTGAACAGCCAGG + Intronic
930394659 2:50805685-50805707 TTAATTCAAAATAAAAAGCATGG - Intronic
935201275 2:100858827-100858849 TTAAATCCAAATAAACAGGACGG - Intronic
935245570 2:101216307-101216329 TTTAATAAAAATGAACAGCCAGG + Intronic
935333393 2:101994016-101994038 GTAATACCAAATGATCAGCTGGG - Intronic
936669975 2:114645830-114645852 TTGACTCCAAATGAACCTCCAGG + Intronic
939825481 2:147010242-147010264 TTAAATCTAAATGCACAGCTAGG + Intergenic
941488511 2:166112951-166112973 TTTATTGTAAAGGAACAGCCTGG - Intronic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
1169598877 20:7233565-7233587 TTAATGTTAAAAGAACAGCCAGG - Intergenic
1170510021 20:17066975-17066997 TTAATAATAAATGAACAGCCTGG - Intergenic
1171976314 20:31596870-31596892 TGAATTAGAAATAAACAGCCTGG - Intergenic
1175007554 20:55701480-55701502 CTAATACCAAATGCACAGGCAGG - Intergenic
1175661930 20:60820967-60820989 TAAATGCCAAGTGAACAGCAAGG + Intergenic
1175918483 20:62438637-62438659 GTAATTCCACAGGAAAAGCCTGG + Intergenic
1178032835 21:28547237-28547259 TTAATGCTAACTGAACAGCAGGG - Intergenic
1183835410 22:40448575-40448597 TTATTTCCAAAGGAATAGCTAGG - Intronic
950608669 3:14109794-14109816 GTAATTGCACATGAACAGGCTGG - Intergenic
950854761 3:16094784-16094806 TTAAACCCACATGAACAGGCAGG + Intergenic
951046274 3:18042071-18042093 TTAATTCCAAAAAATCAGACAGG + Intronic
956066426 3:65401618-65401640 TTGATTCGATATGAACAGCCTGG - Intronic
958259438 3:91363153-91363175 ATAATTCCAAATGAAAATTCAGG + Intergenic
959439312 3:106357672-106357694 TTAACTCCAAATGATCACACTGG - Intergenic
962249900 3:133829459-133829481 CTGGTTCCAAATGCACAGCCAGG + Intronic
962627828 3:137244566-137244588 TTTATTCCAATTGAACAGACTGG + Intergenic
963885556 3:150577893-150577915 TTAACTACAAATGAACAGAATGG - Intronic
965657688 3:171006368-171006390 TTAACTCCAATTGGACAGTCAGG + Intronic
965807269 3:172554915-172554937 ATATTTCCAAATGCACAGCGTGG + Intergenic
965897125 3:173592126-173592148 TGACTTCCAAATGAACAGGGAGG - Intronic
967162182 3:186748660-186748682 TTGCTTTCAAATGCACAGCCAGG + Intergenic
967733309 3:192926347-192926369 TAAATTCCAAATGTATAACCTGG + Intergenic
972309091 4:37863446-37863468 GAAATACCTAATGAACAGCCAGG - Intergenic
978372679 4:108044718-108044740 TTAAGTCCAAATTACCATCCAGG + Intergenic
981744597 4:148040253-148040275 CTATTTCCACATGAAGAGCCTGG + Intronic
985392377 4:189503982-189504004 TTAGTTCCAGATGAACAACCAGG - Intergenic
986162477 5:5242267-5242289 TTGAATCCTAATGAGCAGCCCGG + Intronic
986661646 5:10065221-10065243 TAAATTCCCAATAACCAGCCAGG + Intergenic
987067019 5:14299764-14299786 TAAATTCCACATGAACACTCTGG - Intronic
987294112 5:16535219-16535241 TTGACCCCAACTGAACAGCCTGG - Intronic
987312407 5:16693413-16693435 TGAACTCCAAAGGGACAGCCTGG + Intronic
988448539 5:31315556-31315578 TTAATTCCAAATGAACAGCCTGG + Intronic
989800451 5:45531877-45531899 TAAAATGCAAAAGAACAGCCAGG + Intronic
990342294 5:54835348-54835370 TTATTTCCAAATTAAATGCCTGG - Intergenic
990388718 5:55295936-55295958 TAATTTCTAAATGAAAAGCCAGG + Intronic
990528358 5:56650564-56650586 TTAATTCCACTTAATCAGCCTGG + Intergenic
993465022 5:88234558-88234580 TTAATACCAAAGGAAAAGACTGG - Intronic
996867658 5:128145130-128145152 GTATTTCCAGATGAAAAGCCTGG + Intronic
998810086 5:145957815-145957837 TTAAAACCAAAAGACCAGCCAGG + Intronic
998928880 5:147158147-147158169 TTAATTAATATTGAACAGCCAGG - Intergenic
1001261139 5:170230035-170230057 TTAATTGATAATGAACAGACAGG + Intergenic
1002101050 5:176857836-176857858 TTAATTCCAAGCGGGCAGCCAGG + Intronic
1003475082 6:6474333-6474355 TTTCTGCAAAATGAACAGCCTGG + Intergenic
1004242028 6:13932404-13932426 TTAATTCAAATTGAACAGATTGG + Intronic
1004402436 6:15301148-15301170 AAAATTCCAAAGGAACAGCAAGG + Intronic
1005716085 6:28549862-28549884 TAGATTTCAAATGGACAGCCTGG + Intergenic
1006165127 6:32059947-32059969 TGAATTCCAAATGCTCAGTCAGG - Intronic
1008007187 6:46423231-46423253 TTATTTCCAAATGAGGAGACTGG + Intronic
1010748031 6:79586657-79586679 CTCTTTCCACATGAACAGCCTGG + Intergenic
1011028156 6:82892096-82892118 TTAATGCCAATTGAGCAGCAAGG + Intergenic
1013240769 6:108243633-108243655 TGAAATCCACATGAAGAGCCAGG + Intronic
1015167502 6:130214428-130214450 TTAAATCCATCAGAACAGCCTGG + Exonic
1016205516 6:141463318-141463340 TTAATTCCAAACTCACAGCCTGG + Intergenic
1017867494 6:158456535-158456557 TTAATTCAAAATGCTCAGGCCGG + Intronic
1017964372 6:159251366-159251388 TCACTTCCAAGTGGACAGCCTGG + Exonic
1018305167 6:162447377-162447399 TTAATTACATATGAAAAGCTTGG + Intronic
1018986498 6:168641570-168641592 TAAATTCCAAGTGCACACCCTGG + Intronic
1021075134 7:16294027-16294049 TCAACTCAAAATGAAAAGCCTGG + Intronic
1021685188 7:23178693-23178715 TTAAATCCAAATGCACAGTCAGG - Intergenic
1025085833 7:56022580-56022602 TGAATTCCTGATGCACAGCCAGG - Intronic
1025222276 7:57123536-57123558 TAAATTTCAAAAGATCAGCCAGG + Intronic
1025266655 7:57465643-57465665 TAAATTTCAAAAGATCAGCCAGG - Intronic
1025633058 7:63295217-63295239 TAAATTTCAAAAGATCAGCCAGG + Intergenic
1025649639 7:63452966-63452988 TAAATTTCAAAAGATCAGCCAGG - Intergenic
1025720957 7:64012606-64012628 TAAATTTCAAAAGATCAGCCAGG - Intergenic
1028482803 7:91326144-91326166 TCAAATCCAAGTGAACAGACCGG + Intergenic
1028808293 7:95054418-95054440 TTAAATCCAAAATAAAAGCCAGG - Intronic
1029792195 7:102855866-102855888 TTAATTCCCAATGCACAGATTGG + Intronic
1030465833 7:109902175-109902197 TTATTGGCAAATGTACAGCCTGG + Intergenic
1033067104 7:138166685-138166707 ATAATTCAAAATGAATAGACAGG + Intergenic
1042051386 8:64712148-64712170 TTAATTGCAAAAGAAAAGTCAGG - Intronic
1043441136 8:80278036-80278058 TTAAATAGAAAAGAACAGCCTGG - Intergenic
1045639885 8:104237741-104237763 TTAATTGTAAATGCAGAGCCTGG + Intronic
1046224976 8:111266426-111266448 TTTCTTCCAAATGATCAGCTAGG - Intergenic
1049923064 9:383102-383124 AAAAGTCCAAAGGAACAGCCGGG + Intronic
1051074248 9:13211102-13211124 CTAATTTCAAATGAACCCCCTGG - Intronic
1051694780 9:19756205-19756227 TTACCTCCAAATGCCCAGCCAGG + Intronic
1051843753 9:21428469-21428491 TCAGTTGAAAATGAACAGCCAGG - Intronic
1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG + Exonic
1056422758 9:86445623-86445645 TTAATTAGAAAAAAACAGCCAGG + Intergenic
1056785868 9:89592148-89592170 TGAATTCCAAGTGGGCAGCCTGG - Intergenic
1058422887 9:104849857-104849879 ATAATTCCAAATGAAGTGGCAGG + Intronic
1059877653 9:118653493-118653515 TTAATTACAAATGATGAGTCTGG + Intergenic
1060131724 9:121106677-121106699 CTAATTTCAAATGAACAGACAGG - Intronic
1060253152 9:122002206-122002228 TTCCTTGCAAATGAACACCCAGG - Intronic
1188545641 X:31303106-31303128 TTAAATTAAAATGAAAAGCCTGG - Intronic
1189508886 X:41641193-41641215 TTAATTCAGAAAAAACAGCCTGG - Intronic
1189678429 X:43487772-43487794 TTACTTCCAAATGACCACACTGG + Intergenic
1194809532 X:98373809-98373831 TTAGTTCCAAATGTACAGGATGG - Intergenic
1195588385 X:106593804-106593826 TTAATTCCAAATGAATTGTAGGG - Intergenic
1197271735 X:124431932-124431954 TTCATTGCAAATGAATAGCTAGG + Intronic
1197555245 X:127945436-127945458 TTAATACCAAATGAACCACAGGG + Intergenic