ID: 988453425

View in Genome Browser
Species Human (GRCh38)
Location 5:31365661-31365683
Sequence CATGATACTCAGATGGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988453421_988453425 16 Left 988453421 5:31365622-31365644 CCTGATTTTAGGAGAAACTAATC No data
Right 988453425 5:31365661-31365683 CATGATACTCAGATGGAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988453425 Original CRISPR CATGATACTCAGATGGAGAG AGG Intergenic
No off target data available for this crispr