ID: 988456307

View in Genome Browser
Species Human (GRCh38)
Location 5:31390007-31390029
Sequence CAAAATGCTAATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988456307_988456310 4 Left 988456307 5:31390007-31390029 CCCATATCACTATTAGCATTTTG No data
Right 988456310 5:31390034-31390056 CAACCATTCAACCAGTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988456307 Original CRISPR CAAAATGCTAATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr