ID: 988458239

View in Genome Browser
Species Human (GRCh38)
Location 5:31407605-31407627
Sequence GTTCATTCCATTATCTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988458239 Original CRISPR GTTCATTCCATTATCTTTGT TGG (reversed) Intronic
905071221 1:35227177-35227199 TCTTATTTCATTATCTTTGTAGG + Intergenic
906695037 1:47817925-47817947 TTTCGTTCAATTATGTTTGTGGG - Intronic
907256663 1:53184451-53184473 CTCATTTCCATTATCTTTGTTGG - Intergenic
909165023 1:72211179-72211201 CTTCCTTCCAATATATTTGTTGG + Intronic
911717899 1:101155991-101156013 GTTCATTACAGCATCTTTGCTGG - Intergenic
913227391 1:116712222-116712244 GTTCTATCAATAATCTTTGTGGG + Intergenic
915295667 1:154919733-154919755 GTTCATTCCTTTTTTTTTATTGG - Intergenic
916707968 1:167372824-167372846 GTGTATTAAATTATCTTTGTGGG + Intronic
917879262 1:179317723-179317745 TTTCATTCACTTATCTGTGTAGG + Intronic
918730642 1:187990511-187990533 ATTCATTTCTTTTTCTTTGTTGG + Intergenic
919996063 1:202751760-202751782 GTTCATTCATCTATCTCTGTAGG + Intronic
920577681 1:207073708-207073730 TGTCATTTCATTTTCTTTGTAGG + Exonic
921667021 1:217884797-217884819 GTGCATTTCTTTATCTTTCTGGG + Intergenic
923284575 1:232480757-232480779 ATTTATTCCATTGTGTTTGTTGG + Intronic
924137974 1:240990917-240990939 GTTGATTACATTTTCTTTCTAGG + Intronic
1063264169 10:4428193-4428215 CTTCATTTCATTAGCTCTGTAGG + Intergenic
1063330883 10:5158039-5158061 GTTCTTTCCATTTTATTTCTGGG - Intergenic
1064187367 10:13174070-13174092 TTCCATTCCATTTTATTTGTGGG - Intronic
1065081704 10:22135937-22135959 ATTCATTCAATTATTTTTGAGGG + Intergenic
1066024569 10:31341753-31341775 GTTCCTTTTCTTATCTTTGTGGG - Intronic
1067153761 10:43757732-43757754 GCTCATTCAATGATCATTGTTGG - Intergenic
1068029342 10:51687907-51687929 GTTCACTCAATTATCTGTGAAGG + Intronic
1070747096 10:78940348-78940370 GGTCTGTCCATTATCTATGTAGG + Intergenic
1071966748 10:90858966-90858988 CTTCATTCCATTTTGTTTGAAGG + Intergenic
1073945219 10:108742539-108742561 TGTCAGTCTATTATCTTTGTGGG - Intergenic
1074560136 10:114528330-114528352 TTTCATTTCCTGATCTTTGTGGG - Intronic
1075093624 10:119457028-119457050 GCTCCTTCCATTACCTTTCTTGG + Intronic
1076084964 10:127619330-127619352 GGTAGTTCCATTCTCTTTGTTGG + Intergenic
1077949159 11:6936177-6936199 GTTGGTTCTATTATTTTTGTGGG - Intronic
1079061241 11:17250846-17250868 GAACATTCCTTTATCTTTGGAGG - Intronic
1079750831 11:24194620-24194642 CTTCATCTCATTACCTTTGTGGG - Intergenic
1082843623 11:57709942-57709964 GTTCAAACCATTATCTTTCCTGG + Intronic
1085113208 11:73907245-73907267 CTTAATTCCATCATCTTTTTTGG + Intronic
1085146524 11:74203967-74203989 GTCCATGCCAATATCTTTCTTGG + Intronic
1085539620 11:77254351-77254373 TTTCCTTCCATTCTCTATGTGGG + Intronic
1086616679 11:88830073-88830095 CTTCTTTCCATTATCTCTTTTGG - Intronic
1086636696 11:89097610-89097632 GTTTATTCAATTTTCTTAGTTGG - Intergenic
1087193504 11:95281532-95281554 GTTCTTGTCATTATCCTTGTTGG + Intergenic
1087196160 11:95306106-95306128 GTTCATTCCCTTGCCTTTGGGGG + Intergenic
1088937098 11:114413508-114413530 GCTAATTCTAGTATCTTTGTTGG + Intronic
1089277212 11:117345571-117345593 GTTCATACCATTCACTGTGTTGG + Intronic
1094082374 12:26551740-26551762 GTTCATACCATTCCCTTTGCAGG - Intronic
1097751135 12:63354254-63354276 ATTCCTTCCATTATTTTTCTTGG - Intergenic
1097780263 12:63694923-63694945 TTTCATTTCATGTTCTTTGTTGG + Intergenic
1098112417 12:67137084-67137106 GTGCATTCCCTTATCTGTGGGGG + Intergenic
1098798024 12:74917982-74918004 TTTCATTCCATCTTCTTTCTAGG + Intergenic
1099691214 12:85954323-85954345 TTTTATTCCATTTTCTTTCTTGG - Intergenic
1100748246 12:97669098-97669120 GTTCATTCCATTCACGATGTTGG + Intergenic
1100846649 12:98665783-98665805 ATTGATCCCATTACCTTTGTAGG - Exonic
1101288506 12:103341506-103341528 TTCCATTTCATCATCTTTGTTGG - Intronic
1102767565 12:115446871-115446893 GTTCACCCCATTATCTTTGTAGG + Intergenic
1105972840 13:25446558-25446580 GTTCATTCCATTATCTTTTTTGG + Intronic
1107394389 13:40000258-40000280 TTTCATTCCCTTACCTTTGTTGG - Intergenic
1108980875 13:56511966-56511988 TTTCTTTCTTTTATCTTTGTAGG + Intergenic
1109957177 13:69583402-69583424 GTTCATTTCAGCATCTATGTCGG + Intergenic
1111269390 13:85861256-85861278 GTTAATTCTATTATCCTTGAAGG + Intergenic
1112723643 13:102276994-102277016 AATCCTTCCATCATCTTTGTAGG - Intronic
1114185210 14:20396012-20396034 GTCCACTCTATTAGCTTTGTGGG + Intronic
1116101797 14:40447645-40447667 TTTCAGTCCATTATATTTATTGG - Intergenic
1116121854 14:40730901-40730923 GTTCATGCCATTCTCCTGGTAGG + Intergenic
1116148536 14:41106609-41106631 GTACATTCAACTGTCTTTGTAGG + Intergenic
1117471241 14:56047381-56047403 GTTTACTACATTTTCTTTGTTGG - Intergenic
1120796875 14:88643814-88643836 GTACATTTCATTGACTTTGTAGG + Intronic
1121999290 14:98633319-98633341 CTTCATTCCATTCTCTTTTAAGG + Intergenic
1122962705 14:105104064-105104086 ATTCTTTCCCTTATCTTTCTGGG - Intergenic
1124403620 15:29374318-29374340 TTCCATTCCATTTCCTTTGTTGG + Intronic
1127619558 15:60720427-60720449 GTTCGTTCCAGTATTTTTATTGG - Intronic
1128252300 15:66171860-66171882 TTTCATTCCCTCATCTTTCTTGG + Intronic
1128695044 15:69755498-69755520 CTTCAATCCATCATCTTTCTAGG - Intergenic
1129011602 15:72423310-72423332 GTTGCTTCCATTATCTCTGCAGG - Intergenic
1135879797 16:26243571-26243593 GTTCCTTCCATAACCTTTTTAGG - Intergenic
1135963832 16:27019786-27019808 GTTCATTGCATTGTCTTTTCGGG + Intergenic
1138068264 16:53964584-53964606 GTTCTTTCCATTAAATGTGTTGG + Intronic
1138162292 16:54765671-54765693 GCCCATTCCATTTTCTTTCTTGG - Intergenic
1140193145 16:72835127-72835149 GTTCTTTCCTTTTTCTTTGGAGG + Intronic
1143975425 17:10825790-10825812 TTTCATTTCATTTTCTTTTTTGG - Intronic
1144019279 17:11225750-11225772 CTTCATGCCATCCTCTTTGTAGG - Intergenic
1144268270 17:13592610-13592632 GTTCATTCACTTATCTTTATTGG - Intronic
1148288613 17:46419981-46420003 TTTCATTCCTTTAACTTTATAGG + Intergenic
1148310782 17:46637559-46637581 TTTCATTCCTTTAACTTTATAGG + Intronic
1153237283 18:3000178-3000200 GCCCATTCCTTTATCCTTGTTGG - Intronic
1153570042 18:6461777-6461799 GCTCATTCCATTGTTTTTGGAGG + Intergenic
1153807442 18:8721589-8721611 GCTCATTCCCTTATCTCTTTCGG + Intronic
1157955011 18:52087038-52087060 CTTCATTCAATTAACTTTTTTGG + Intergenic
1164681794 19:30139432-30139454 GTTTATTACATTATCTATTTTGG - Intergenic
1166972570 19:46579593-46579615 TTTATTTCCATTATGTTTGTGGG - Intronic
925553918 2:5107355-5107377 GTGCATTCCATTATGATTGAAGG + Intergenic
927346017 2:22041884-22041906 CTTCATTCCATTGTGGTTGTAGG - Intergenic
927809817 2:26174602-26174624 ATTCAATCCATAATCTTTATTGG - Intronic
929375569 2:41282656-41282678 GTTCATTCATTTAATTTTGTGGG + Intergenic
930384138 2:50671883-50671905 GCTCATTCTATTTTCTTTTTGGG - Intronic
932788546 2:74631454-74631476 GTTTATTATATTATCTTTCTTGG + Intronic
933056129 2:77668156-77668178 TTTTATTCCATTTTCTTTTTCGG - Intergenic
933364886 2:81339634-81339656 CTTCATTCCATTGTGTTTGCAGG - Intergenic
933927628 2:87112139-87112161 TTTTATTCCATTTTCTTTTTCGG - Intergenic
935675544 2:105592425-105592447 TTTCATTCTTTTAGCTTTGTGGG + Intergenic
935816838 2:106853664-106853686 GATGATACCATTATCTTTCTGGG + Intronic
936292224 2:111235076-111235098 GTTCATTCCTTTTTATTGGTAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
936751167 2:115643939-115643961 GTTCTTGTCTTTATCTTTGTTGG + Intronic
936764506 2:115830477-115830499 GTACATTCAATAATGTTTGTTGG - Intronic
937414154 2:121700892-121700914 GTTCATTGCATTAACTTTGAAGG - Intergenic
938035353 2:128030229-128030251 GTTCAATACATTAACTTTGAGGG - Intergenic
940474102 2:154138374-154138396 GTTGTTTACAATATCTTTGTAGG - Intronic
940515587 2:154680458-154680480 GTTAATTCCAATAACTTTGCAGG + Intergenic
941213417 2:162672085-162672107 GATCAATTCATTATCGTTGTGGG + Intronic
941281751 2:163560633-163560655 GTTCATTCCTGTATTTTGGTTGG + Intergenic
941706117 2:168659862-168659884 ATTAATGCCATTTTCTTTGTAGG + Intronic
943984047 2:194595881-194595903 CTTCATTCCATTCTATTTTTCGG + Intergenic
944970536 2:204987839-204987861 TTTCATTCCATTAGCTTTTTGGG + Intronic
945152272 2:206803709-206803731 GTTCATTCGATTAACTTGGAAGG - Intergenic
945202816 2:207300792-207300814 CTTCATTCCATCATATTTGGAGG - Intergenic
946883399 2:224198596-224198618 GGTGATTTCATTATCTGTGTTGG + Intergenic
1169425591 20:5494761-5494783 GTCCTTTCCTTTCTCTTTGTAGG + Intergenic
1169485862 20:6031978-6032000 GTTAATTACTTTATCTTTTTTGG + Intronic
1170198373 20:13715026-13715048 GTTCTTTCCGTTCTCTTTGCCGG + Exonic
1171723210 20:28587368-28587390 GTTCATTTCATTTTATTTTTAGG - Intergenic
1171754838 20:29095739-29095761 GTTCATTTCATTTTATTTTTAGG + Intergenic
1171787814 20:29486803-29486825 GTTCATTTCATTTTATTTTTAGG - Intergenic
1171860134 20:30392588-30392610 GTTCATTTCATTTTATTTTTAGG + Intronic
1176789903 21:13308544-13308566 TTACATTCCATTATGTTGGTAGG - Intergenic
1180296771 22:10946018-10946040 GTTCATTTCATTTTATTTTTAGG - Intergenic
1180411835 22:12619542-12619564 GTTCATTTCATTTTATTTTTAGG + Intergenic
1182780829 22:32866145-32866167 GTTGATTCCTTTATCTTGTTCGG - Intronic
1183584273 22:38743078-38743100 ATTTATTCCATTTTCTCTGTGGG - Intronic
949118372 3:356397-356419 GTTCATTCAATAATATTTATGGG + Intronic
951582590 3:24181790-24181812 ATTCTTTCCATTGTCTTTATTGG + Intronic
951718442 3:25673740-25673762 GGTCATCCCATTATCTCTTTGGG + Intergenic
952782072 3:37111293-37111315 TTTCATTCCATTTTCTCTGAGGG - Intronic
953138536 3:40205311-40205333 GTTCACTCCATTAGCTCTTTAGG - Intronic
953494718 3:43376107-43376129 GTTCTTGCCATGCTCTTTGTTGG - Intronic
956191828 3:66615219-66615241 TTTCATTCCATTATGACTGTAGG + Intergenic
957008728 3:74981165-74981187 GTTCATTCCTTTACTTTTGTGGG + Intergenic
961194095 3:124986799-124986821 GTCCTCTCCATTATTTTTGTGGG - Intronic
961848483 3:129790390-129790412 GTTCATACCCCTATCTCTGTAGG - Intronic
961860714 3:129915107-129915129 GTTCATTCACTCATCATTGTTGG - Intergenic
962174426 3:133138151-133138173 CTTCATTTTATTTTCTTTGTGGG - Intronic
964066219 3:152583147-152583169 CATCATTACATTAACTTTGTAGG - Intergenic
964209537 3:154211713-154211735 TTCTATTCCATTATCTTAGTTGG + Intronic
964654365 3:159050646-159050668 GTATTTTCTATTATCTTTGTGGG + Intronic
967485005 3:190020120-190020142 GTTTCTTCCATTATCTGTGGTGG + Intronic
968168839 3:196491802-196491824 GTCCATTCCATTTCCTTTTTTGG - Intronic
970571466 4:17387404-17387426 GTTCATTCAATTATCTAAGCTGG - Intergenic
970814819 4:20142407-20142429 TTTCATTCTATTTTCTTTGTTGG - Intergenic
971584748 4:28391154-28391176 GTTGTTTCCACTATCTTTGGTGG + Intronic
972699756 4:41482714-41482736 GGACATTCCATTATCATTATTGG - Intronic
974095352 4:57357790-57357812 GTTCATTCCATCATCTTAGAAGG + Intergenic
974539676 4:63218440-63218462 ATTCTTTCTTTTATCTTTGTGGG + Intergenic
975433001 4:74317103-74317125 GTTCCTACCATTAATTTTGTAGG + Intergenic
976566349 4:86554458-86554480 GTTGATTCCATTAACCTTGATGG - Intronic
977669650 4:99681640-99681662 TTTCTTTCCATTCTCTTTTTGGG - Intergenic
980669207 4:135981987-135982009 GTTCATTTGATTAACTTTCTAGG - Intergenic
981070471 4:140530791-140530813 GTATATTCCATTTACTTTGTAGG + Intronic
981261377 4:142723903-142723925 GTTTATGTCATTATCTTTCTGGG - Intronic
982283937 4:153715196-153715218 CTTCTTTCCCTGATCTTTGTTGG + Intronic
983719993 4:170839034-170839056 GTACATTCAATTTCCTTTGTGGG + Intergenic
983977348 4:173951904-173951926 GTTTCTTACATTAACTTTGTGGG + Intergenic
984629345 4:182044260-182044282 GTTCTTTCCTTTCTTTTTGTTGG - Intergenic
985114117 4:186574285-186574307 GTTCAGTCCATTCTCTCTGTTGG - Intergenic
986562951 5:9081809-9081831 GTTCAGTCCACTATTTTTGAGGG + Intronic
987829715 5:23079431-23079453 TTTCTTTCCATTATGTTTGAGGG + Intergenic
987919550 5:24261547-24261569 GTTCATTATATTCTCTGTGTAGG + Intergenic
988101474 5:26684839-26684861 GGTCATTTCATTGTATTTGTAGG - Intergenic
988458239 5:31407605-31407627 GTTCATTCCATTATCTTTGTTGG - Intronic
990760363 5:59122666-59122688 CTTCAGTAAATTATCTTTGTTGG - Intronic
991468985 5:66947368-66947390 GTTCATACATTTTTCTTTGTAGG - Intronic
992035989 5:72776613-72776635 GTTCATTGCTGTAGCTTTGTTGG - Intergenic
993012575 5:82500024-82500046 GTTCTTTCATTTGTCTTTGTGGG + Intergenic
994831399 5:104787421-104787443 TTGAATTCCAGTATCTTTGTAGG - Intergenic
995858504 5:116618254-116618276 CTTCATTCCTTTATTTTTTTGGG + Intergenic
996665960 5:126060496-126060518 GTTACTACAATTATCTTTGTAGG + Intergenic
996782200 5:127199443-127199465 TTGCATTCCATTTTCTTGGTAGG - Intergenic
997587065 5:135049673-135049695 GTTCATTCCATTTTATTTCTGGG - Intronic
1000684639 5:164233133-164233155 ATACATTCCATTCTGTTTGTTGG + Intergenic
1003725102 6:8752283-8752305 GTTCATGTCATTGACTTTGTAGG + Intergenic
1003992894 6:11504441-11504463 AGTCATTCCATTATCTTTCAGGG + Intergenic
1005190840 6:23221597-23221619 CTTCTTTCCATTATCTTACTTGG - Intergenic
1008430200 6:51407375-51407397 GTGCTTTCTATTATGTTTGTGGG - Intergenic
1009765765 6:68073415-68073437 GTTCCATACATTATCTTTATTGG + Intergenic
1009876361 6:69510626-69510648 TTTTATTCCAATATCTTTTTTGG - Intergenic
1011021935 6:82824181-82824203 GTTCATTTTAGTATTTTTGTGGG - Intergenic
1011037744 6:82996407-82996429 GTTCATTCAATTATATTTTAAGG - Intronic
1011082506 6:83505170-83505192 GTAGTTTCCATTATATTTGTGGG + Intergenic
1012419900 6:99053319-99053341 GTTTATTTCATTAATTTTGTGGG + Intergenic
1012637647 6:101564892-101564914 GTTCATTCCATTCATTCTGTAGG + Intronic
1013145551 6:107387437-107387459 GCTGATACCATTATTTTTGTAGG + Intronic
1013732182 6:113181395-113181417 ATTCATTCCCTTTTCTTTCTGGG + Intergenic
1014947235 6:127514022-127514044 GTTCATTGCATTAACTTCATTGG - Intronic
1015696405 6:135985028-135985050 CTTCATTCCATTATTTCTGAGGG - Intronic
1016878365 6:148885929-148885951 TTTCATTCCATTAGCTTGTTTGG + Intronic
1017637577 6:156457486-156457508 GTTCATTCAATTATTTATTTGGG - Intergenic
1018019827 6:159751050-159751072 GTGCTTTCTATTATGTTTGTGGG + Intronic
1018560162 6:165093681-165093703 CTTCTTTCCATTTTCTTTGTGGG - Intergenic
1018778112 6:167037148-167037170 GTTCATTCAGTTTTCTTTCTTGG + Intronic
1020879713 7:13744697-13744719 TTTCATTTGATTATATTTGTTGG + Intergenic
1021335091 7:19390411-19390433 TTTTATTTCATTATATTTGTGGG + Intergenic
1021802544 7:24321828-24321850 GTTTCTTCTATTCTCTTTGTGGG - Intergenic
1022851826 7:34271215-34271237 GTTCATTCCATTTACTCTATTGG - Intergenic
1022938842 7:35211000-35211022 TTTCATTTCATGTTCTTTGTTGG + Intronic
1023305442 7:38821265-38821287 ATACAATCCATTTTCTTTGTAGG - Exonic
1023345598 7:39268219-39268241 CTACATTCCATTATCTTTGATGG - Intronic
1024091194 7:45941390-45941412 GTTCATTTGGTCATCTTTGTAGG - Intergenic
1026431461 7:70351521-70351543 GTTAATTTCATTTTCTTTGGAGG + Intronic
1026617325 7:71917037-71917059 GTTAAATCCATTATCTTTAGAGG - Intronic
1028486514 7:91364253-91364275 TTTCATTCTCTTTTCTTTGTTGG - Intergenic
1028722268 7:94047279-94047301 GTTCATTCGGCTATCTTTGAAGG - Intergenic
1028749120 7:94362598-94362620 CTTCATTGACTTATCTTTGTGGG - Intergenic
1030557579 7:111046301-111046323 TTTAATTGCATTATCTTTCTGGG - Intronic
1031044737 7:116875094-116875116 GTTGATTCCACTTTTTTTGTGGG - Intronic
1031449714 7:121899945-121899967 GTCCATTCCAATAGCTTTGCAGG - Intronic
1031495605 7:122444151-122444173 GTTCATTCCTTTTTATTGGTGGG + Intronic
1032147830 7:129400105-129400127 ATCCATTCCTTTGTCTTTGTTGG - Intronic
1032633699 7:133682606-133682628 GTTTATACCATTAAGTTTGTTGG + Intronic
1039131147 8:34265426-34265448 GTTTATTCCAAAATGTTTGTGGG - Intergenic
1039193997 8:35009803-35009825 CTATATACCATTATCTTTGTCGG + Intergenic
1039287455 8:36057826-36057848 GTCCTTTCCCTTATCTTTCTTGG + Intergenic
1041185204 8:55292445-55292467 GTTCATACCATTCTCTTTTATGG + Intronic
1043033098 8:75163879-75163901 GTTCCTTCCTTTATCTATTTGGG + Intergenic
1043351628 8:79368208-79368230 GTTAACCCCATTTTCTTTGTTGG + Intergenic
1043932600 8:86107977-86107999 GTTGATTCCAATATGTTAGTTGG + Intronic
1044721502 8:95153753-95153775 TTTCATTCAATTATGTCTGTAGG + Intronic
1044973416 8:97641957-97641979 GTTCATTCCTTTTTATTTCTGGG + Intergenic
1045680221 8:104651252-104651274 GTTCATTCCATAAATATTGTTGG + Intronic
1045682324 8:104676027-104676049 GTTCAATCCTTTACCTTTATCGG - Intronic
1047983730 8:130211336-130211358 GTTAATGCCAACATCTTTGTAGG + Intronic
1048037246 8:130688865-130688887 AATCATTCCATTATTTTGGTGGG + Intergenic
1048170767 8:132104124-132104146 GGTCATTCCCTTCTCTTTCTTGG + Exonic
1051476531 9:17515032-17515054 GTTTATTCCATTGTCATTTTTGG + Intergenic
1051756326 9:20404870-20404892 GGCCAGTCAATTATCTTTGTGGG - Intronic
1052487222 9:29117914-29117936 GTTCATTCCAGTACGCTTGTGGG - Intergenic
1053726886 9:41013001-41013023 GTTCATTTCATTTTATTTTTAGG + Intergenic
1055726879 9:79239880-79239902 GCAAATTCCATTATGTTTGTGGG + Intergenic
1057006728 9:91567378-91567400 GTCCATTCCATTATGGTTCTTGG + Intronic
1058967565 9:110051086-110051108 GTTCATTTCACTTTCTTTCTGGG + Intronic
1061973519 9:134057005-134057027 GTTCTTTCCAGTGTCTGTGTGGG - Intronic
1202803629 9_KI270720v1_random:27185-27207 GTTCATTTCATTTTATTTTTAGG - Intergenic
1203448424 Un_GL000219v1:84258-84280 GTTCATTTCATTTTATTTTTAGG - Intergenic
1185971118 X:4665379-4665401 GTTCCTTCCATTGTGATTGTTGG + Intergenic
1186189296 X:7053306-7053328 GTGCCTTCCATTATCTCTTTGGG - Intronic
1187557944 X:20369894-20369916 GTTCATTGCAGTATTTTTGAGGG + Intergenic
1188427920 X:30070368-30070390 GTGTATTCTATTATCATTGTGGG - Intergenic
1189882637 X:45508229-45508251 TTTTATTCCACTATTTTTGTTGG - Intergenic
1191122758 X:56923178-56923200 TTGCCTTTCATTATCTTTGTTGG + Intergenic
1193745804 X:85279275-85279297 ATTCATTCCATTAGATTTCTTGG + Exonic
1195837162 X:109129469-109129491 GTTCACAAAATTATCTTTGTTGG + Intergenic
1197803903 X:130381028-130381050 GTACATTCCCTTATCTGTGAAGG + Intergenic
1201887571 Y:18902366-18902388 GTTCATTCCTTTATTTTTGTTGG - Intergenic