ID: 988459388

View in Genome Browser
Species Human (GRCh38)
Location 5:31419129-31419151
Sequence CTGTCACGGTGCACTTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988459388_988459392 6 Left 988459388 5:31419129-31419151 CCCAGGAAAGTGCACCGTGACAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 988459392 5:31419158-31419180 ACAAAGCTTGTGTTTCAAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 213
988459388_988459395 13 Left 988459388 5:31419129-31419151 CCCAGGAAAGTGCACCGTGACAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG No data
988459388_988459394 12 Left 988459388 5:31419129-31419151 CCCAGGAAAGTGCACCGTGACAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 988459394 5:31419164-31419186 CTTGTGTTTCAAGAAGGAGGAGG 0: 1
1: 0
2: 4
3: 32
4: 263
988459388_988459393 9 Left 988459388 5:31419129-31419151 CCCAGGAAAGTGCACCGTGACAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 988459393 5:31419161-31419183 AAGCTTGTGTTTCAAGAAGGAGG 0: 1
1: 0
2: 3
3: 31
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988459388 Original CRISPR CTGTCACGGTGCACTTTCCT GGG (reversed) Intronic
900880752 1:5379709-5379731 CTGCGACGATGCAGTTTCCTAGG + Intergenic
906087509 1:43148503-43148525 TTGTCACTGAGCACTCTCCTTGG + Intronic
907291629 1:53417296-53417318 CTGTCACGGAGCTCTTTTATGGG - Intergenic
913197318 1:116468387-116468409 CTGTTAAGATGCACATTCCTGGG - Intergenic
917640133 1:176975370-176975392 TTGTCACGGAGCACTATCCTGGG + Intronic
922182924 1:223250037-223250059 GTGCAAAGGTGCACTTTCCTGGG + Intronic
1064111119 10:12539795-12539817 TTGCCAGGGTGCATTTTCCTTGG - Intronic
1068156545 10:53206296-53206318 CCACCACGGTGGACTTTCCTAGG - Intergenic
1068532863 10:58209145-58209167 CTGTCAGGCTGCACTTACCCTGG + Intronic
1072172161 10:92875040-92875062 CTGTGTTTGTGCACTTTCCTAGG + Intronic
1073425975 10:103455766-103455788 GAGTCACGGGGCACTGTCCTTGG + Intronic
1084670846 11:70605792-70605814 CTGTTGCCGTGCAGTTTCCTCGG - Intronic
1084833597 11:71787444-71787466 CTGCCCCGGTGCACTGCCCTGGG + Intergenic
1091297151 11:134482055-134482077 CTGTCACTGAGCACTTTTCGTGG + Intergenic
1091558055 12:1590721-1590743 CTGTAAGGAAGCACTTTCCTGGG - Intronic
1091847426 12:3668367-3668389 GTGTTATGGTGCACGTTCCTGGG + Intronic
1092931197 12:13317502-13317524 TTCTCACAGTGCTCTTTCCTGGG - Intergenic
1092931885 12:13323516-13323538 TTGTCACAGGGCTCTTTCCTGGG + Intergenic
1098243120 12:68488290-68488312 ATGTCAGGGTGCCCTTTGCTTGG - Intergenic
1109915250 13:68976507-68976529 CTCTCACAGTGCACTTTTCCAGG - Intergenic
1112004955 13:95245896-95245918 TTGTCACGGTGCATTTTGTTGGG - Intronic
1112930084 13:104723997-104724019 CTTTCATGGTGCACTTTGTTAGG + Intergenic
1113650664 13:112032093-112032115 CTGGCATGGGGCTCTTTCCTCGG - Intergenic
1115430248 14:33309246-33309268 ATGTCACGGTTCACCTGCCTTGG + Intronic
1118319381 14:64744103-64744125 CTGTAACGGTGCCTTTTCTTAGG + Exonic
1121019862 14:90573312-90573334 CTGTCCCGATGCTCTTTCCATGG + Intronic
1130451134 15:84053449-84053471 CTTTCATGGTGCTTTTTCCTTGG + Intergenic
1133895646 16:9926113-9926135 CTGTCAAGGGGAACTCTCCTTGG + Intronic
1136274503 16:29170473-29170495 CTGTCCAGCTGCACTTTCATAGG - Intergenic
1138777202 16:59737537-59737559 CTGAAACTGTGCACTTTCCAAGG + Intronic
1142260745 16:89041485-89041507 CTGCCATGGGGCCCTTTCCTGGG - Intergenic
1143523555 17:7460216-7460238 CTGTCTCTTTGCACTTTTCTTGG - Exonic
1151224898 17:72640642-72640664 CTGCCCCGGTGCACGTTCCCAGG - Intergenic
1151570589 17:74923594-74923616 CGGTCACGGTGCCCCTTCTTAGG - Intergenic
1155971184 18:32085311-32085333 CTGTGAGGCTGCACTTTCTTTGG - Intergenic
1159836296 18:73340471-73340493 TTCTCACGGGGCACTTTTCTGGG - Intergenic
1160544715 18:79645303-79645325 CTGTCACAGTGCACATTTCATGG + Intergenic
1164258440 19:23549390-23549412 CTGTCATGTTGCACTTGCCTAGG - Intronic
927748865 2:25648170-25648192 CTGTCACCTTTCACTTTTCTTGG + Intronic
930977247 2:57478686-57478708 CTGTCAAGAGACACTTTCCTCGG + Intergenic
932570293 2:72934905-72934927 CTGGCACGTTGCTCTTTCTTGGG - Intronic
937217742 2:120323466-120323488 GTGTCACATTGCCCTTTCCTGGG + Intergenic
939440014 2:142235330-142235352 CTGTCACGGGTCACTTTCAAAGG - Intergenic
941185028 2:162311664-162311686 TTGTCACAGTGCATTTCCCTAGG + Intronic
943279449 2:185912776-185912798 CTGTTAGGGTGAACTTTCCTTGG - Intergenic
946042138 2:216791702-216791724 GTGTTACTGTGCATTTTCCTGGG + Intergenic
946325148 2:218981218-218981240 CTCTCACGGTCCTCCTTCCTGGG - Exonic
1169926473 20:10789744-10789766 GTGTCCCAGTGCACTTTCTTTGG - Intergenic
1172812789 20:37661598-37661620 CTATCACGGTGACCTTTCTTGGG + Intergenic
1177849283 21:26327467-26327489 CTGGCACGGTAAACTTTCCAAGG + Intergenic
1183157374 22:36085739-36085761 CGGGCACGGTGCCCTTTGCTTGG - Intergenic
953492708 3:43364355-43364377 CTGTCTCTGGGCACTTTTCTTGG + Intronic
954382897 3:50228996-50229018 CTGGCAAGGTGCACCTTGCTTGG + Intronic
958596103 3:96225878-96225900 CTTTCACTGTGAATTTTCCTGGG - Intergenic
967135951 3:186512804-186512826 CTGTCACAGTGGCCTTGCCTGGG + Intergenic
970270972 4:14347324-14347346 CTGTCAGGGTCCACTTCCCTGGG + Intergenic
970725269 4:19036505-19036527 CTTTCATGGTGCATGTTCCTAGG - Intergenic
984922055 4:184773825-184773847 CTGACACGGTGTGCTTACCTTGG + Exonic
988459388 5:31419129-31419151 CTGTCACGGTGCACTTTCCTGGG - Intronic
989064049 5:37442008-37442030 CTTTCCCTGTGAACTTTCCTAGG - Intronic
994417861 5:99497838-99497860 CTTTCCCTGTGAACTTTCCTAGG - Intergenic
994462103 5:100077318-100077340 CTTTCCCTGTGAACTTTCCTAGG + Intergenic
997584906 5:135038402-135038424 CTGTCCCCGTGCCCTTTCCCGGG - Intronic
1000308409 5:160017646-160017668 TTGTCACAGTGCAGTTTCTTAGG + Intronic
1001175882 5:169468592-169468614 TTCTCTCTGTGCACTTTCCTAGG + Intergenic
1005854483 6:29850460-29850482 CTGTCACGTTGCCCTTCCCTGGG + Intergenic
1006511762 6:34525447-34525469 CTGTCAGGGTTCACAGTCCTGGG + Intronic
1007493185 6:42240277-42240299 CAGGCACTGTGCACTGTCCTAGG + Intronic
1013595337 6:111655539-111655561 CAGTCACTGGGCACTTTGCTGGG + Intergenic
1015955662 6:138595532-138595554 CTGTCACTGTGCTCTAGCCTAGG + Intronic
1016847861 6:148587147-148587169 CTGTCAGGTTGCTCTTTCATAGG + Intergenic
1017111163 6:150934024-150934046 CTCACTCGGTGCACTGTCCTTGG + Intronic
1021149787 7:17135380-17135402 CTGACAGGATGCACTCTCCTTGG - Intergenic
1025803914 7:64811261-64811283 CTGTTACAGAGCACTTTGCTGGG - Intronic
1032055488 7:128681285-128681307 CTATCAAGGTGACCTTTCCTAGG + Intronic
1047334091 8:123919703-123919725 CTGTCATGGTGCTCTTTATTTGG + Intronic
1051024965 9:12597662-12597684 CTGTGTCTGTGAACTTTCCTAGG - Intergenic
1052493803 9:29200179-29200201 CTGTGATGGAGCATTTTCCTAGG - Intergenic
1054815680 9:69472814-69472836 TTGACACAGTGCTCTTTCCTTGG + Intronic
1056231501 9:84550124-84550146 CTCTCTCGGTGCACTTTCTCTGG + Intergenic
1057434705 9:95029164-95029186 CTGTCACCGTGCACTCTCTTGGG + Intronic
1058057527 9:100464007-100464029 CTATGACAGTGCTCTTTCCTGGG + Intronic
1061944885 9:133903172-133903194 GTGTCCCGGGGCACTCTCCTGGG - Intronic
1062242635 9:135548421-135548443 CTGCCACTGTCCCCTTTCCTGGG + Intronic
1185587138 X:1248595-1248617 CTGGCAGGGTTCACTGTCCTGGG + Intergenic
1187665499 X:21604734-21604756 CTGGCAGGGTGATCTTTCCTTGG + Intronic
1190846465 X:54196836-54196858 CTGTCAAGTTGCACTTTACTGGG - Exonic
1192212468 X:69136736-69136758 GAGTCACGGTGCATTTTCCCAGG + Intergenic
1196476637 X:116093849-116093871 TTGGCATGTTGCACTTTCCTAGG + Intergenic