ID: 988459389

View in Genome Browser
Species Human (GRCh38)
Location 5:31419130-31419152
Sequence TCTGTCACGGTGCACTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988459389_988459392 5 Left 988459389 5:31419130-31419152 CCAGGAAAGTGCACCGTGACAGA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 988459392 5:31419158-31419180 ACAAAGCTTGTGTTTCAAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 213
988459389_988459393 8 Left 988459389 5:31419130-31419152 CCAGGAAAGTGCACCGTGACAGA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 988459393 5:31419161-31419183 AAGCTTGTGTTTCAAGAAGGAGG 0: 1
1: 0
2: 3
3: 31
4: 254
988459389_988459395 12 Left 988459389 5:31419130-31419152 CCAGGAAAGTGCACCGTGACAGA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG No data
988459389_988459394 11 Left 988459389 5:31419130-31419152 CCAGGAAAGTGCACCGTGACAGA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 988459394 5:31419164-31419186 CTTGTGTTTCAAGAAGGAGGAGG 0: 1
1: 0
2: 4
3: 32
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988459389 Original CRISPR TCTGTCACGGTGCACTTTCC TGG (reversed) Intronic
904301657 1:29558199-29558221 TCGGCCACGGTGCAACTTCCAGG - Intergenic
904455828 1:30647513-30647535 TCTGGCACAGTGCACCATCCTGG - Intergenic
907291630 1:53417297-53417319 TCTGTCACGGAGCTCTTTTATGG - Intergenic
917239174 1:172929068-172929090 TCTGTCTAGGTGGACTTTCCAGG - Intergenic
917640132 1:176975369-176975391 ATTGTCACGGAGCACTATCCTGG + Intronic
917745028 1:177998252-177998274 ACTGTGACGATGCATTTTCCCGG - Intergenic
924945965 1:248847165-248847187 TCTGTTACAGTGCCCTTTCCAGG + Exonic
1072247232 10:93554581-93554603 TATCTCAAGGTCCACTTTCCAGG + Intergenic
1073257634 10:102164001-102164023 TGTCTCACGGTGCCTTTTCCAGG + Intergenic
1073259179 10:102175776-102175798 ACTGTCCCGGTGTACTTTCAGGG - Intergenic
1080884513 11:36354014-36354036 TCTGTCACGGTGTACTCTCCTGG - Intronic
1084833596 11:71787443-71787465 TCTGCCCCGGTGCACTGCCCTGG + Intergenic
1087505099 11:99010715-99010737 TCTTCCACTCTGCACTTTCCAGG + Intergenic
1089455522 11:118623398-118623420 TCTGCCACTGTGCACACTCCAGG + Intronic
1089580512 11:119479009-119479031 TCTGTCCCTGTGCTCTTCCCTGG + Intergenic
1091847425 12:3668366-3668388 TGTGTTATGGTGCACGTTCCTGG + Intronic
1095448760 12:42307637-42307659 TCTGTCACAGTCCCCATTCCTGG - Intronic
1097611133 12:61822547-61822569 TCATTCACTGTGCACCTTCCTGG + Intronic
1102661781 12:114535252-114535274 TCTGTCACTTTGTGCTTTCCCGG - Intergenic
1106500936 13:30328092-30328114 TCTATCACTGTGCAGTTCCCTGG - Intergenic
1108511331 13:51158589-51158611 TCTGTCACCTTGCACTTTGTAGG + Intergenic
1113068741 13:106397335-106397357 TCTGTCACCCTGCAATCTCCGGG + Intergenic
1113225907 13:108159307-108159329 TCTGTCACTGTGCTCTTGCTCGG - Intergenic
1119471918 14:74905828-74905850 TCTGACACGGTCCACGTGCCTGG - Exonic
1122663883 14:103315856-103315878 TCTGTCACGAGGCACGTGCCTGG - Intergenic
1128942529 15:71800296-71800318 TCTGTCATGTTACACTTTGCTGG - Intronic
1133849319 16:9486888-9486910 TCTTTCACTGTGCATTTTCAGGG - Intergenic
1141913214 16:87075244-87075266 TCTGTCACGCTTCAGTGTCCCGG + Intergenic
1145035533 17:19537856-19537878 TCTGTCGGGGAGGACTTTCCAGG - Intronic
1154064060 18:11090170-11090192 ACTGTAACGGTGCCTTTTCCTGG + Intronic
1155865201 18:30956336-30956358 TCTGGCACCAGGCACTTTCCAGG - Intergenic
1157201958 18:45667210-45667232 TCTGTTACTGTGGTCTTTCCTGG + Intronic
1157320214 18:46628474-46628496 TCCTTCACGGAGCACTCTCCAGG - Intronic
937217741 2:120323465-120323487 TGTGTCACATTGCCCTTTCCTGG + Intergenic
937799110 2:126060715-126060737 CCTCTCACAGTGCCCTTTCCTGG + Intergenic
941629992 2:167873764-167873786 TCTGTAAAAGTGCACTCTCCAGG + Exonic
948496089 2:238350869-238350891 TCTCTCTCGGTGCACTTGCTTGG - Intronic
1168875573 20:1169857-1169879 TCTGTCCCAGTGCACCTTCCAGG - Intronic
1171294221 20:24003570-24003592 TCTGTCAGGGTGCAGATTTCAGG + Intergenic
1172812788 20:37661597-37661619 TCTATCACGGTGACCTTTCTTGG + Intergenic
1178333653 21:31724006-31724028 TCTGGTACAGTGCACTTTACTGG + Intronic
1182554106 22:31119723-31119745 TCTTCCTCGGTTCACTTTCCAGG - Intronic
949157250 3:844054-844076 GCTGTCACGCTGCACATTCTTGG + Intergenic
949978288 3:9480847-9480869 TATGTCACTTTACACTTTCCTGG + Intergenic
956725135 3:72150815-72150837 TCTGTTACGATGCACTTTTAAGG - Intergenic
956763629 3:72465356-72465378 TCTCTCACTCAGCACTTTCCTGG - Intergenic
958596104 3:96225879-96225901 TCTTTCACTGTGAATTTTCCTGG - Intergenic
960582261 3:119290783-119290805 ACTGTCATGGTGCAATTTACTGG - Intergenic
966161874 3:176977079-176977101 TCCATCACGGTGACCTTTCCTGG - Intergenic
969151823 4:5176230-5176252 TCTGACCCGTTGCACTTCCCAGG + Intronic
970019148 4:11547374-11547396 TCTGTCCCTCTGCACTTCCCAGG + Intergenic
970270971 4:14347323-14347345 ACTGTCAGGGTCCACTTCCCTGG + Intergenic
973318709 4:48788050-48788072 TCCTTCACTTTGCACTTTCCAGG - Intergenic
974771691 4:66423080-66423102 TCTGTCATTGTGCACTGCCCAGG - Intergenic
986484116 5:8218004-8218026 TCTGTCATGGGGCCCTTTGCAGG + Intergenic
987964193 5:24850992-24851014 TCTGTCACAGTGCAACTTTCAGG - Intergenic
988459389 5:31419130-31419152 TCTGTCACGGTGCACTTTCCTGG - Intronic
994811616 5:104526335-104526357 TCTTTCACTGTGAACTTTCTTGG + Intergenic
995410733 5:111854344-111854366 TCTGTCAGGGAGCACTTTGTAGG + Intronic
995929544 5:117422051-117422073 TATGTCACGTTGTACTTTTCAGG + Intergenic
997584907 5:135038403-135038425 GCTGTCCCCGTGCCCTTTCCCGG - Intronic
1005854482 6:29850459-29850481 CCTGTCACGTTGCCCTTCCCTGG + Intergenic
1013595336 6:111655538-111655560 TCAGTCACTGGGCACTTTGCTGG + Intergenic
1018228653 6:161655048-161655070 TCTGTGACGGTGCACCTTGGTGG - Intronic
1019001993 6:168761612-168761634 TGTGTCACGGAGCATTTCCCGGG + Intergenic
1019611153 7:1937314-1937336 TGTGGCACGGGGCACCTTCCAGG - Intronic
1024297574 7:47857717-47857739 TCTGTCCAGGTGCATTTACCTGG - Exonic
1024393749 7:48843347-48843369 ACTGTCCCGGTGTACTTTCAGGG + Intergenic
1024401501 7:48929068-48929090 ACTGTCCCGGTGTACTTTCAGGG - Intergenic
1027000863 7:74653271-74653293 TCTGTCACCGTGGGCTTTCAGGG + Intergenic
1034312092 7:150097734-150097756 TCTGTCACTGTCTCCTTTCCTGG - Intergenic
1034794765 7:154002924-154002946 TCTGTCACTGTCTCCTTTCCTGG + Intronic
1036207011 8:6813096-6813118 TCTGTCATGCTGCAATCTCCTGG - Intronic
1039125268 8:34194397-34194419 TGTGTCACAGTCCACTGTCCCGG - Intergenic
1057434704 9:95029163-95029185 CCTGTCACCGTGCACTCTCTTGG + Intronic
1061944886 9:133903173-133903195 TGTGTCCCGGGGCACTCTCCTGG - Intronic
1185587137 X:1248594-1248616 TCTGGCAGGGTTCACTGTCCTGG + Intergenic
1186122345 X:6376958-6376980 TCTGTCACTCTGAACTTCCCAGG + Intergenic
1190799051 X:53771641-53771663 TCTGTGACACTGCACTCTCCTGG - Intergenic
1190846466 X:54196837-54196859 ACTGTCAAGTTGCACTTTACTGG - Exonic
1191097501 X:56688856-56688878 TCTGGCTCCTTGCACTTTCCAGG + Intergenic
1193052308 X:77114718-77114740 TTTGTCACAGTGCAGTTTCATGG - Intergenic
1194391089 X:93319307-93319329 CCTGACACCGTGCACTTCCCTGG - Intergenic
1194980532 X:100435670-100435692 TCAGTCACAGTTCACTTTCAGGG + Intergenic
1201021208 Y:9658913-9658935 TCTGTCACTTTGCTCTTTCATGG - Intergenic
1201498733 Y:14618327-14618349 CCTGTCGCCGTGCACTTCCCAGG + Intronic