ID: 988459390

View in Genome Browser
Species Human (GRCh38)
Location 5:31419143-31419165
Sequence AGCTTTGTTGGCTTCTGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988459390_988459393 -5 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459393 5:31419161-31419183 AAGCTTGTGTTTCAAGAAGGAGG 0: 1
1: 0
2: 3
3: 31
4: 254
988459390_988459395 -1 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG No data
988459390_988459394 -2 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459394 5:31419164-31419186 CTTGTGTTTCAAGAAGGAGGAGG 0: 1
1: 0
2: 4
3: 32
4: 263
988459390_988459397 23 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459397 5:31419189-31419211 GCAGCCATGTTAATGCTAATGGG 0: 1
1: 0
2: 0
3: 6
4: 76
988459390_988459396 22 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459396 5:31419188-31419210 AGCAGCCATGTTAATGCTAATGG 0: 1
1: 0
2: 1
3: 5
4: 129
988459390_988459392 -8 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459392 5:31419158-31419180 ACAAAGCTTGTGTTTCAAGAAGG 0: 1
1: 0
2: 2
3: 17
4: 213
988459390_988459399 29 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459399 5:31419195-31419217 ATGTTAATGCTAATGGGAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988459390 Original CRISPR AGCTTTGTTGGCTTCTGTCA CGG (reversed) Intronic
900821350 1:4891523-4891545 AGCTATGTTGGCTGCTGAGAAGG + Intergenic
900985057 1:6068528-6068550 AGCTTTCCTTGCTGCTGTCACGG + Intronic
901514625 1:9736629-9736651 CTCTTTGTTGTCATCTGTCAAGG - Intronic
901672009 1:10861637-10861659 AGCTTTAATGCCCTCTGTCAGGG + Intergenic
902113981 1:14106217-14106239 AGCTGTGTTGGGTTCTGTTGGGG - Intergenic
903075239 1:20759566-20759588 AGCATGGTTGGGTTCTGTGAGGG - Intronic
906566097 1:46802158-46802180 CAATTTGTTGGCTTCTTTCAAGG - Intronic
907040228 1:51252368-51252390 TGCTGTCTTGGCTTCTGTCTTGG - Intronic
908085336 1:60626006-60626028 TTCTCTGTTGGCATCTGTCAAGG - Intergenic
910211272 1:84795920-84795942 AGCTCTGTAAGCTTCTGTCTTGG + Intergenic
913172352 1:116244158-116244180 AGCTATGTTTTATTCTGTCAGGG + Intergenic
913188230 1:116389686-116389708 AGGTTTGCTGGCCACTGTCACGG + Exonic
916617158 1:166453805-166453827 AGTTTTGTTGGATTCTGAGATGG - Intergenic
917773734 1:178310704-178310726 AGATTTGTTTACTTCTGTGAAGG + Intronic
917947523 1:179990551-179990573 AGCTGTGTGTGATTCTGTCATGG + Exonic
917963526 1:180164574-180164596 AGCTTAGTTGCCTTCTTTCCAGG + Intronic
918625321 1:186650427-186650449 AGCTTTGTTGTATTTTGTTATGG + Intergenic
921591018 1:217003503-217003525 AGCTTTATTTGCTTGTCTCATGG + Intronic
922924778 1:229339577-229339599 ACCTTTCTTGGCTTCTCTCTTGG - Intronic
923838198 1:237638471-237638493 AGATTTGCTGTCTTCTGTAATGG + Exonic
924090872 1:240499472-240499494 AGTTTTGTTTGGTTCTGCCATGG - Intronic
924333611 1:242965069-242965091 GGCTCTGTTGGCCTCTCTCATGG + Intergenic
924661368 1:246021262-246021284 AGCTTTGAAGCCTTCTGACATGG + Intronic
1062890264 10:1054488-1054510 AGCATTGTTGCCCTATGTCAGGG + Intronic
1063863678 10:10340857-10340879 AGAATTTTTGGCTTCTGACAAGG + Intergenic
1064332448 10:14406459-14406481 ATCATTGTTGGTTTCTGTAAGGG + Intronic
1064340219 10:14478779-14478801 AGCTTTGGTGGCTTCTGACTTGG - Intergenic
1065152280 10:22834190-22834212 AGCTTTGTTGACTTTTTTAATGG + Intergenic
1066246024 10:33584111-33584133 ACCTTGGTTGGCTGCTGTCAGGG + Intergenic
1070849541 10:79552391-79552413 AGCTTATCTGGCTTCTGTCCTGG + Intergenic
1071423194 10:85522627-85522649 AGCTTTGTTTGCTACTAGCAGGG - Intergenic
1071479699 10:86055889-86055911 AGCACTGTTGGTTTCTGGCAAGG - Intronic
1071849128 10:89550709-89550731 AGCTATGTTGGCTTTTCTCTGGG + Intronic
1073033287 10:100545419-100545441 ATCATTGTTTGCTTTTGTCATGG + Intronic
1073043008 10:100620137-100620159 AGCTTTCCTGGCTGCTGACATGG + Intergenic
1074013141 10:109504779-109504801 TGCTTTGTTTCCTTCTGTGATGG - Intergenic
1074585123 10:114761104-114761126 AGCTTTATCGGTTTCTTTCATGG - Intergenic
1076409520 10:130235856-130235878 AGCTTTATTGCCTTTTGTGATGG - Intergenic
1079371685 11:19859075-19859097 AGTCTTGTGGGCATCTGTCAGGG + Intronic
1080228192 11:29984813-29984835 AGCTGTGTGGGCAACTGTCAGGG + Intergenic
1083616526 11:64029084-64029106 AGCTTTATTGGCATCTGTTGGGG + Intronic
1085445685 11:76599253-76599275 GGCTTTGTTGGCTACCCTCATGG - Intergenic
1087738029 11:101856410-101856432 AGCGTTGTTGAATTTTGTCAAGG - Intronic
1088142098 11:106629866-106629888 AGCACTGTTGGCTTCTCACATGG + Intergenic
1088830506 11:113532446-113532468 AGCCCCGTTGGCTTTTGTCATGG - Intergenic
1090786484 11:130053253-130053275 TGCTCTCTTGCCTTCTGTCATGG - Intergenic
1090889200 11:130907958-130907980 AGCCTTCTTGCCTTCTGTCTGGG + Exonic
1092609290 12:10154608-10154630 AGCTTTGGTGGTTACTTTCAAGG - Intergenic
1093527447 12:20118423-20118445 AGCGTGGTTGGCTTCTGGCGAGG + Intergenic
1093716877 12:22392732-22392754 TGCTTTCATGGCTTCTGTAAGGG - Intronic
1095156017 12:38855420-38855442 AGCTTTGTTCTTTTTTGTCAAGG - Intronic
1097082748 12:56444899-56444921 AGATTTGCTGGCTTCTGGCTTGG - Intronic
1097321282 12:58229150-58229172 AGCATTGTTGAATTTTGTCAAGG + Intergenic
1105890239 13:24677402-24677424 AGAGTTCTTGGCTTCTGCCAGGG - Intergenic
1107563703 13:41580942-41580964 TGCCTTGTTTTCTTCTGTCAAGG + Intronic
1108520763 13:51244986-51245008 AGGTTTGTTGTCTTCTGCCAAGG + Intronic
1108834575 13:54526772-54526794 AGTTTTTTTCGCTTATGTCAAGG + Intergenic
1108956617 13:56166544-56166566 AGCCTTCATGGCTTCTCTCAAGG + Intergenic
1110633625 13:77738924-77738946 AGCTTTGTTGCCTTCTTGCATGG + Intronic
1111432118 13:88158625-88158647 TGCTGTGTGGGCTTCTGTGATGG + Intergenic
1114737971 14:25062657-25062679 AGCTTGGTTGGGTTCTGTGAGGG + Intergenic
1116053764 14:39838176-39838198 AGCATTGTCGGTTTCTATCAAGG - Intergenic
1116601834 14:46935682-46935704 AGCTTTGTGGGCATTTATCATGG - Intronic
1120113317 14:80583705-80583727 AGGTTTGTGGGCTTCAGTCAAGG - Intronic
1120854104 14:89197787-89197809 ATCTTTGTAGGAATCTGTCAGGG + Intronic
1121112458 14:91321491-91321513 GGCTTTGCTGGGGTCTGTCAGGG + Intronic
1121452068 14:94015042-94015064 AACTTTGTTGGCATCTGTCATGG - Intergenic
1124113491 15:26816118-26816140 AGTTTTGTTGAATTCTATCAGGG - Intronic
1124363768 15:29057014-29057036 GCCTTTGTTGGCTCCTGGCACGG - Intronic
1124645167 15:31433458-31433480 AGCTGTGTTCCCTTCTCTCAGGG + Intronic
1125159023 15:36622433-36622455 AGCTGTGTGGACTTCTGTCATGG + Intronic
1125251064 15:37705032-37705054 AACTGTGGTGGCTGCTGTCAGGG + Intergenic
1130655856 15:85791816-85791838 AGCTTTGTTAGCTTTTTTCAGGG - Intronic
1135103043 16:19623517-19623539 AACTAGGTTGGCTTCTGTCACGG - Intronic
1138089771 16:54164808-54164830 AGCTCTGATGTCTTCTGGCAGGG + Intergenic
1139139844 16:64248087-64248109 AGCATTGTTGGTTTCTGAAATGG + Intergenic
1140391061 16:74587200-74587222 TGGTTTGTTGCCTTCTCTCAGGG - Intronic
1140524995 16:75615283-75615305 AGCTTTCTTGGTTTTTTTCAGGG + Intronic
1142228764 16:88889639-88889661 AGACCTGTTGGCCTCTGTCAAGG - Intronic
1144188210 17:12816145-12816167 TTCTTTGTTGGCTTCCTTCATGG - Intronic
1147436574 17:40420194-40420216 AGCATGGCTGGTTTCTGTCAGGG - Intergenic
1148516878 17:48227410-48227432 ATCTTTCTTGGTTTCTGTCTGGG + Intronic
1150860176 17:68793346-68793368 AGCAATCTTGGCTTCTCTCAGGG + Intergenic
1154294949 18:13139667-13139689 AGCTTATTTGGCTTTTGACAGGG - Intergenic
1155605660 18:27602677-27602699 AGCTGTGTTGGCTTCTCACATGG - Intergenic
1158376358 18:56873677-56873699 TGCTTCATTGGCTTCTTTCAGGG + Intronic
1158527233 18:58225912-58225934 AGTTTTGTTTTCTTCTGCCATGG + Intronic
1159728648 18:71996210-71996232 TGCAGTGTTGGCTTCTGTCATGG + Intergenic
1160600190 18:80006630-80006652 AGGTTTGTTGCCTCATGTCAAGG + Intronic
1160807099 19:996723-996745 AGCTTTGCTGGCAGCTGTCCCGG - Intronic
1165277077 19:34763569-34763591 AGCATTGTTGGGTTCTGATAAGG - Intronic
1166346856 19:42171813-42171835 AACCTTGTTGGTTTCTGTGAGGG + Intronic
924983011 2:240227-240249 AGCTTGGCTTGCCTCTGTCAGGG - Intronic
926523265 2:13944103-13944125 AGCTATGTTGGAATCTGACAAGG - Intergenic
926728614 2:16017739-16017761 AGCTTTGGTGGCCTCTGGCCTGG - Intergenic
927284242 2:21339845-21339867 AGCATTGTTGAATTTTGTCAAGG - Intergenic
928028912 2:27762278-27762300 ACCTCTGTTGGCTTCTGTAAAGG - Intergenic
928774387 2:34741091-34741113 AGATTTGTTAGTTTCTCTCAGGG - Intergenic
930285012 2:49416572-49416594 AACATTTTTGGCTTCTGTAATGG + Intergenic
930752641 2:54947984-54948006 GGCTTTGTTTGCTGCTTTCAAGG + Intronic
931099432 2:58979221-58979243 AGCCCTGTTGGCTTCTTTCTCGG - Intergenic
933368548 2:81386831-81386853 AACTTGCTTGCCTTCTGTCAGGG - Intergenic
938052357 2:128186007-128186029 AATTTTGCAGGCTTCTGTCAAGG - Intronic
938195926 2:129327918-129327940 TTCTTTAATGGCTTCTGTCAGGG - Intergenic
939664795 2:144937878-144937900 AGCTTGGTTGGCCTTTTTCAGGG + Intergenic
939930525 2:148228320-148228342 AGCATTGTTGAATTTTGTCAAGG + Intronic
939971636 2:148668645-148668667 AGCTTTGATTACTTCTTTCAAGG + Intronic
942751489 2:179292795-179292817 AGCATGGTTGGGTTCTGGCAAGG - Intergenic
942796142 2:179822050-179822072 AGTTCTGTTGGCTTCTTTGAAGG - Intronic
945313317 2:208341596-208341618 AGCATGGTTGGGTTCTGGCAAGG + Intronic
946747128 2:222857272-222857294 AGCTCTCTTGGATTCTGTGAAGG + Intergenic
1170585021 20:17728109-17728131 GTCTTTGCTGGCTTCTGCCAAGG + Intronic
1171138339 20:22718821-22718843 AGTTGTTTTGGCTTCTTTCAGGG + Intergenic
1172298214 20:33829075-33829097 AGAATTGTTGGCCTCTGTCTTGG + Intronic
1172971260 20:38874583-38874605 TGCTTTGATGGCTTCTCTCCAGG + Intronic
1174443241 20:50572998-50573020 AGCTCTGTTGGCTTCTGGTCTGG + Intronic
1178834545 21:36085410-36085432 AGCTGTGCTGGCCTCTGCCAAGG + Intergenic
1178968729 21:37150666-37150688 AGCTTTCTGGGCTTTTGTCTGGG + Intronic
1180255811 21:46626636-46626658 ATGTTTTTTGGCTTTTGTCATGG + Intergenic
1184908812 22:47511766-47511788 AGCATGGTTGGGTTCTGTGAGGG - Intergenic
952048158 3:29349255-29349277 AGCTTTTTTGTCTCCTGTCCAGG - Intronic
952734701 3:36677361-36677383 AGCTTTGTTGGTTTCGGGGAGGG - Intergenic
955018532 3:55095958-55095980 ATCTTTGTTGGTTTGTCTCATGG - Intergenic
959528268 3:107402095-107402117 AGCTTTTGTGTCTTCTCTCAGGG + Intergenic
960842322 3:121972525-121972547 AGGTTTGTTGTCTCATGTCAAGG - Intergenic
962940869 3:140123688-140123710 AGCATGGTTGGCTTCTGGTAAGG + Intronic
964029522 3:152120424-152120446 AGCCATGTTGGCATCTATCAAGG + Intergenic
965881586 3:173395195-173395217 ATCATTGTTGGCTTTTGTGACGG - Intergenic
967177062 3:186870663-186870685 TTCTTTGTTGGCCTCCGTCATGG - Intergenic
969808467 4:9628980-9629002 AGCATTGTTGAATTTTGTCAAGG - Intergenic
970030286 4:11666453-11666475 AACTTAGGTAGCTTCTGTCAAGG + Intergenic
970808193 4:20060708-20060730 AGTTTTTTTGGCATCAGTCATGG - Intergenic
971968305 4:33591594-33591616 AGCTTCGTTGCCTCATGTCAAGG - Intergenic
972335188 4:38101585-38101607 AGCTTTGTTGGATGCTCACATGG + Intronic
973589087 4:52422238-52422260 ATCTCTGTTGGCTTCTGAAAGGG + Intergenic
973937220 4:55859045-55859067 ACCTGTGTTGACATCTGTCATGG + Intronic
977214760 4:94268054-94268076 AGCTTTGTTGCTTACTATCACGG - Intronic
978459331 4:108933304-108933326 ACATTTGTTGGTTTGTGTCATGG - Intronic
979045622 4:115858816-115858838 AGGTTTGTTGGCTGCTGATATGG - Intergenic
979701691 4:123675505-123675527 AGTTTTGCTTGGTTCTGTCAGGG - Intergenic
979959892 4:127005875-127005897 AGCTTTGTTGAATTTTGTAATGG - Intergenic
981222436 4:142253170-142253192 AGCTCTGAAGGCTTCTTTCATGG - Intronic
981456080 4:144954495-144954517 AGCTGTGTTAGCTGCTGACAGGG - Intergenic
982885941 4:160783045-160783067 AGCTTTGTTGGGCTCAGTCCAGG + Intergenic
983442947 4:167810586-167810608 AGCTATGTTCGATGCTGTCAAGG + Intergenic
986987401 5:13514930-13514952 AGCTTTCCTGGCTGCTTTCATGG - Intergenic
988459390 5:31419143-31419165 AGCTTTGTTGGCTTCTGTCACGG - Intronic
989218846 5:38932688-38932710 AGCTTTGATTTCTTCTGTCAGGG + Intronic
989449170 5:41566742-41566764 AGGGTTGTTGACTTTTGTCACGG + Intergenic
989744259 5:44809111-44809133 AGCTTTGCTGTCGGCTGTCATGG - Exonic
991630933 5:68655800-68655822 AGGGTTCTTGGCTTCTGCCAAGG + Intergenic
992107501 5:73462104-73462126 AGGTTTGTTGCCTTATGCCAAGG - Intergenic
993124073 5:83810235-83810257 AGATTTGATTGTTTCTGTCAGGG + Intergenic
993876411 5:93312328-93312350 GGCTTTATTGGCTTCTAACATGG - Intergenic
995670697 5:114599127-114599149 AGCTTTGTTCGTTCCTGACAAGG - Intergenic
997765354 5:136497918-136497940 TTCTTTGTTGACTTCTGTCTTGG + Intergenic
999349843 5:150859136-150859158 AGCGTTGTTGAATTTTGTCAAGG + Intronic
999371779 5:151060053-151060075 AGCCCTGTTGCCTTCTGCCAGGG - Intronic
1000725120 5:164760326-164760348 AGATTAGTAGGTTTCTGTCAGGG + Intergenic
1000947770 5:167442745-167442767 AGCATTGTTTGCCTGTGTCATGG + Intronic
1000953831 5:167518264-167518286 AGCTTTATTGTCACCTGTCATGG - Intronic
1001857630 5:175026558-175026580 AAGTTTGCTGACTTCTGTCATGG + Intergenic
1001938108 5:175720807-175720829 AGCGTTGTTGAATTTTGTCAAGG - Intergenic
1003444202 6:6169864-6169886 AGCTTTGTTGGCTTGATTCCTGG + Intronic
1003822722 6:9917948-9917970 AGCATTGCTGCCTGCTGTCAAGG + Intronic
1004450695 6:15742815-15742837 ATCTTTGCTGGCTGCTGTAAGGG + Intergenic
1004451423 6:15751389-15751411 ACCTTTGCTGGCTGCTGTGAGGG + Intergenic
1005522377 6:26612458-26612480 TGCTTTGTTTTCTTCTGTGAGGG + Intergenic
1007328930 6:41088484-41088506 AGCTGTGTTGGATTCTTTCAAGG + Intronic
1009629940 6:66183846-66183868 AGCTTTGATGGATTTTGTGAAGG + Intergenic
1009827115 6:68880732-68880754 AGCTCTGTTGGCTTTTTTCCTGG - Intronic
1011242215 6:85285093-85285115 AGGTTTGTTCAGTTCTGTCAAGG + Intergenic
1013065019 6:106675738-106675760 AGCTTTGTTGGTTTTTCTTAAGG + Intergenic
1013163356 6:107567497-107567519 AGCTCTGGTGACTTCTCTCAAGG - Intronic
1014905384 6:127020172-127020194 AGTCTCTTTGGCTTCTGTCATGG - Intergenic
1015542252 6:134326762-134326784 AGCATGGTTGGCTTCTGGTAAGG + Intergenic
1016299109 6:142610128-142610150 ACCTTTCCTGGCTTCTGTCCTGG - Intergenic
1017042335 6:150317518-150317540 AGCAGAGTTGGCTTATGTCAGGG + Intergenic
1023793902 7:43775349-43775371 AGCATTGTTGAATTTTGTCAAGG + Intronic
1024575451 7:50759920-50759942 AGTTTTGTTGGTTTCAGTGATGG - Intronic
1027330403 7:77086720-77086742 AGCGTTGTTGAATTTTGTCAAGG + Intergenic
1029785356 7:102784614-102784636 AGCGTTGTTGAATTTTGTCAAGG - Intronic
1030975486 7:116117060-116117082 ATTTTTGTTGGATTCTTTCAAGG - Intronic
1032096716 7:128941906-128941928 AGCTTTCTTGTCTAGTGTCATGG - Intronic
1032565703 7:132940772-132940794 AGCTTTATTGACACCTGTCAAGG - Intronic
1032924227 7:136584535-136584557 AGCTTTGTTAGTTTCTTTGAAGG + Intergenic
1038272525 8:26087167-26087189 AGCAGAGTTGGCTTCTTTCAAGG + Intergenic
1040288500 8:46112441-46112463 AGCCGTGTGGGCTTCTGTGATGG + Intergenic
1040290354 8:46121044-46121066 AGCTTTGGGGGCTTTTGTTATGG + Intergenic
1040299165 8:46179094-46179116 AGCCTTGAGGGCTTCTGGCATGG + Intergenic
1040331584 8:46388399-46388421 AGCTCTGTGGGCTTCTGGGAGGG - Intergenic
1040389315 8:46935955-46935977 AGCTATGTGGGCTTCTCTGAAGG + Intergenic
1041113141 8:54506509-54506531 AACTTTCTTGGTTTCTGTCTTGG + Intergenic
1042070683 8:64930458-64930480 AGTTTTGTTCCCTTCTGGCAAGG + Intergenic
1043173126 8:76990440-76990462 GCCTGTGTTGGCTTCTGACATGG + Intronic
1043539899 8:81249643-81249665 AGTTTTCTTGCCTGCTGTCATGG - Intergenic
1045372958 8:101543348-101543370 GGCCTTGGTGGCTGCTGTCAGGG - Exonic
1045375923 8:101574181-101574203 AGCTTTGTTCTATTCTGTAAAGG + Intronic
1045733536 8:105268239-105268261 AGCTTTATTCCCTTCTGTGAAGG + Intronic
1048417008 8:134237796-134237818 AGCTTTGTTGGCTTGTTTCCAGG - Intergenic
1048513051 8:135079612-135079634 AGGTTTGTTGGCCTCTGTCCTGG + Intergenic
1050914192 9:11110387-11110409 AGGTTTGTTGCATTGTGTCATGG - Intergenic
1051457389 9:17274904-17274926 AACTTTATTGGCTTCAGTAATGG - Intronic
1051696794 9:19776535-19776557 AGCATTTGTGGCTTCTGACAAGG - Intronic
1053219368 9:36299144-36299166 TGCTCTTTTGGCTTCTGCCATGG - Intronic
1055153126 9:73027282-73027304 TGCTTATTTGGCTTCTGTCTTGG - Intronic
1059277413 9:113108217-113108239 AGCCATGCTGGCTGCTGTCAAGG + Intergenic
1059278838 9:113116334-113116356 AGCCATGCTGGCTGCTGTCAAGG - Intergenic
1060969428 9:127729911-127729933 AGGTTTGTGGGCTTATTTCAGGG - Intronic
1061522134 9:131125077-131125099 AGCTTTGTTTGCTCCTATCAAGG - Intergenic
1188087894 X:25924136-25924158 AACTTTGATGGCATCTGTGAGGG - Intergenic
1189371790 X:40434589-40434611 AGGTTTGCTGGTTGCTGTCAGGG + Intergenic
1189377970 X:40480615-40480637 AGCTCTGTTGGCAGTTGTCAGGG + Intergenic
1190363420 X:49669923-49669945 TGCTTTATTGGTTTCTCTCAAGG - Intergenic
1190515140 X:51215994-51216016 ACCCTTGTGGGCTTCTGTTATGG - Intergenic
1194712418 X:97251774-97251796 AGGTTTTATGGCTTCTTTCAAGG + Intronic
1195340235 X:103899325-103899347 AGCGTTGTTGAATTTTGTCAAGG + Intergenic
1195405422 X:104507870-104507892 AGATATTTTGGCTTCTGTCTTGG - Intergenic
1197568018 X:128112460-128112482 AGATTTGTTAACTTGTGTCATGG - Intergenic
1198875879 X:141225826-141225848 AGCGTTGTTGAGTTTTGTCAAGG + Intergenic
1200183967 X:154169772-154169794 GGCTTCCTTGGCTTCTGCCACGG + Intergenic
1200189621 X:154206900-154206922 GGCTTCCTTGGCTTCTGCCACGG + Intergenic
1200195374 X:154244709-154244731 GGCTTCCTTGGCTTCTGCCACGG + Intergenic
1200201026 X:154281830-154281852 GGCTTCCTTGGCTTCTGCCACGG + Intronic
1202052625 Y:20796851-20796873 TGATTTGTTGGCTGCTGCCATGG - Intergenic