ID: 988459395

View in Genome Browser
Species Human (GRCh38)
Location 5:31419165-31419187
Sequence TTGTGTTTCAAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988459388_988459395 13 Left 988459388 5:31419129-31419151 CCCAGGAAAGTGCACCGTGACAG 0: 1
1: 0
2: 0
3: 7
4: 81
Right 988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG No data
988459389_988459395 12 Left 988459389 5:31419130-31419152 CCAGGAAAGTGCACCGTGACAGA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG No data
988459390_988459395 -1 Left 988459390 5:31419143-31419165 CCGTGACAGAAGCCAACAAAGCT 0: 1
1: 0
2: 1
3: 17
4: 206
Right 988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988459395 Original CRISPR TTGTGTTTCAAGAAGGAGGA GGG Intronic
No off target data available for this crispr