ID: 988459652

View in Genome Browser
Species Human (GRCh38)
Location 5:31422547-31422569
Sequence AAGTTTTAGGAGAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988459652_988459656 21 Left 988459652 5:31422547-31422569 CCTTCACACTTCTCCTAAAACTT 0: 1
1: 0
2: 2
3: 27
4: 276
Right 988459656 5:31422591-31422613 GACAATGGAACCAACAACATTGG 0: 1
1: 0
2: 1
3: 11
4: 164
988459652_988459654 6 Left 988459652 5:31422547-31422569 CCTTCACACTTCTCCTAAAACTT 0: 1
1: 0
2: 2
3: 27
4: 276
Right 988459654 5:31422576-31422598 GAAACCAAGATGCATGACAATGG 0: 1
1: 0
2: 0
3: 11
4: 218
988459652_988459657 26 Left 988459652 5:31422547-31422569 CCTTCACACTTCTCCTAAAACTT 0: 1
1: 0
2: 2
3: 27
4: 276
Right 988459657 5:31422596-31422618 TGGAACCAACAACATTGGATTGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988459652 Original CRISPR AAGTTTTAGGAGAAGTGTGA AGG (reversed) Intronic
903547295 1:24133877-24133899 AAGTTTTAGGGTAAATGTGCAGG - Intronic
905173456 1:36122683-36122705 GAGTTTAAGGAGAAAGGTGACGG - Intronic
906105256 1:43287806-43287828 AAGTTTTAGAACTAGAGTGATGG - Intergenic
906550812 1:46665177-46665199 AACTTTAAGGATAAGGGTGAGGG + Intronic
906604800 1:47160656-47160678 CAGTTTTAGTAGAAGAGTAAAGG + Intergenic
908485910 1:64593059-64593081 AACTTTTAGGAGAAAAATGATGG + Intronic
909064224 1:70914540-70914562 AAGTTTTATGAGAAGAGTAAGGG - Intronic
909535172 1:76727985-76728007 AAGTTTTGGGAGAACAGGGAGGG - Intergenic
910192915 1:84612529-84612551 AAGTTTTAGTAAAAATGTCAGGG - Intergenic
911562575 1:99424452-99424474 ATGTTTTAGTAGAAATGTCATGG - Intergenic
911877881 1:103192334-103192356 AACTTTAAGAAAAAGTGTGATGG - Intergenic
912573250 1:110640357-110640379 AAATTATAGGAGAAGTAAGAAGG + Intergenic
913485562 1:119329888-119329910 GTGATTTAGGAGAAGTGTGAAGG + Intergenic
915725164 1:158012008-158012030 AAGTTTGAGGGAAAGTGGGAGGG - Intronic
915839110 1:159201273-159201295 GAGTGTTAGGAGGAGAGTGAAGG + Exonic
917127976 1:171708010-171708032 AAGCTTTAGGCAAAGTGTGGTGG + Intronic
917485034 1:175448104-175448126 AAGTTTGAGGAGAAGAGTACAGG - Intronic
917554716 1:176071798-176071820 AAATTTTAGTAGACTTGTGAAGG - Intronic
917745851 1:178006254-178006276 AAAGTTTTGGAGATGTGTGATGG - Intergenic
919129053 1:193431518-193431540 AAAGTTTAGGAGAAGTGAGGGGG + Intergenic
919593619 1:199534664-199534686 AATTTTTGAGAAAAGTGTGAAGG - Intergenic
920893970 1:210024855-210024877 AAGTTTTAGAAGAAGAAGGAAGG + Intronic
921864855 1:220077875-220077897 AAGATTTAGGCGAAGTGTAATGG + Intronic
922678287 1:227567104-227567126 AAGTTTTAGGAGATGGGACATGG + Intronic
923046446 1:230359512-230359534 AAGTTTTAGAATCAGAGTGATGG + Intronic
1062905745 10:1178465-1178487 AATTTGTGGGAGAAGTTTGACGG + Exonic
1063755638 10:9004427-9004449 AAGTTTTATTAGAGGTGTGTAGG - Intergenic
1064259760 10:13775862-13775884 AACTTTTGGGAGAAAAGTGAAGG + Intronic
1065139324 10:22705127-22705149 AAGTTCAAGGAGAAGTGAAAAGG + Intronic
1066668954 10:37816834-37816856 GTGTTTTAGGAGAAGGGTGCTGG + Intronic
1067824173 10:49557849-49557871 GTGCTTTAGCAGAAGTGTGAGGG + Intergenic
1068770886 10:60819378-60819400 AATTTTTTGTAGAAGAGTGAAGG + Intergenic
1068948885 10:62757774-62757796 AAGTTTTGGGATATGTGTGCAGG + Intergenic
1071211205 10:83343495-83343517 AAGATTTAGGAGAAGAGAGGAGG - Intergenic
1072213644 10:93269932-93269954 AACTTTTTGGAGAAAAGTGATGG + Intergenic
1072221689 10:93332518-93332540 AGCTTTTAAGAGAAGAGTGAGGG - Intronic
1074847858 10:117414326-117414348 AATTTTTAGGAGGAGGATGATGG - Intergenic
1074899322 10:117803038-117803060 AAGATTTGGGAGAAGGGAGAAGG + Intergenic
1077966622 11:7140829-7140851 AACTTATAGGTGAAGTGTGAAGG + Intergenic
1078051876 11:7972519-7972541 AAATTTTTGGAGAAGTGACAAGG + Intronic
1079168481 11:18069006-18069028 TAGCTTCAGGAGAAGTGAGATGG + Intergenic
1079300075 11:19270141-19270163 AAGTTTCAGTAGATGAGTGATGG - Intergenic
1080403347 11:31957014-31957036 AGGTTTTAGGAGATTTGGGAAGG - Intronic
1085184051 11:74560266-74560288 AGCTGTTGGGAGAAGTGTGATGG - Intronic
1087249316 11:95878533-95878555 AAGTTTTTGCAGAAAAGTGAAGG - Intronic
1087536925 11:99459836-99459858 AATCTTTTGGAGAAGTGAGAAGG + Intronic
1090128277 11:124113031-124113053 AAGTTTTAGGTGAATTGCTATGG + Intergenic
1092685330 12:11037750-11037772 AAGTTTTAGGTCAGGTGTGGTGG + Intronic
1093240473 12:16664658-16664680 AAGTTTGAGGAGAGGTGCAACGG + Intergenic
1093500314 12:19804594-19804616 AAATTTTGGGCCAAGTGTGATGG - Intergenic
1093796881 12:23322822-23322844 AAGTTTTGGGAAAGATGTGAAGG + Intergenic
1094186128 12:27644664-27644686 AAGTATTATGAAGAGTGTGATGG - Intronic
1094749937 12:33394353-33394375 AAGATTTAGGAAAAGAGTTAAGG + Intronic
1095609869 12:44114738-44114760 AAGTATTAGTAGAAGTATAAGGG + Intronic
1096595848 12:52695017-52695039 CAGCTGCAGGAGAAGTGTGATGG - Intronic
1098670771 12:73227743-73227765 AATATTTAGGAAAATTGTGAAGG - Intergenic
1098880890 12:75916097-75916119 AAGGTTTAGAAGAGGTGGGAAGG + Intergenic
1101258393 12:103003506-103003528 AAGTTTTAGGGTACATGTGAAGG + Intergenic
1102736675 12:115167641-115167663 AAGTTCTAGGGGCAGAGTGATGG - Intergenic
1104603187 12:130167469-130167491 GAGTTTTAGGAGAAGCATCAAGG + Intergenic
1104890942 12:132139864-132139886 CACTTTCAGGAGCAGTGTGAAGG + Exonic
1105736526 13:23277619-23277641 AATTTTTATGAGAACTGTTAGGG + Intronic
1107291223 13:38856207-38856229 AGGTTTTAGGTGAACAGTGAAGG - Exonic
1108033135 13:46257955-46257977 AAGTTTTACTAAAAGTGTAATGG + Intronic
1108362948 13:49684141-49684163 AACTTTTACTAGAAGCGTGATGG + Intronic
1108926696 13:55757538-55757560 AAGTTTGAGGAGAAAAGAGACGG - Intergenic
1109800234 13:67367401-67367423 GACTCTTAGGAGAAGTGTTAGGG + Intergenic
1110494925 13:76157120-76157142 AAGTATTAAGAGAAGTGAAAGGG - Intergenic
1111318464 13:86592364-86592386 AAAGTTTAGGAGAAGGGTGAAGG + Intergenic
1111512188 13:89280711-89280733 AAGTTTTAGGTAGAGTGGGAAGG - Intergenic
1112113099 13:96324188-96324210 AAGTTTTTGGAGATGTTTAAAGG - Intronic
1112134051 13:96556061-96556083 AAGTTTCAGGAAGAGTCTGAAGG + Intronic
1113608729 13:111628377-111628399 ATGTTTCAGGAGAAATTTGATGG - Intronic
1115634859 14:35281420-35281442 AAGTTTGAGAAGCACTGTGATGG - Intronic
1116509430 14:45725654-45725676 CAATTTTAGGACAAGTGTGGTGG - Intergenic
1117422874 14:55564726-55564748 AAGTTTTTTGAGGTGTGTGATGG + Intronic
1118481523 14:66171931-66171953 AACTTTTAGGAAAAGTGGAAAGG + Intergenic
1120402994 14:84055735-84055757 ACCTTTTAAAAGAAGTGTGAGGG - Intergenic
1120529094 14:85610559-85610581 AAATTTTATGAGAAATGAGAAGG - Intronic
1121171642 14:91859450-91859472 AAGCTTCAGGAGAAGTGGAATGG - Intronic
1121290506 14:92771039-92771061 AACTTTCAGGAGATGTCTGAAGG + Intergenic
1125415581 15:39448749-39448771 ACCTTTTAAGACAAGTGTGAGGG - Intergenic
1125655382 15:41352455-41352477 AAGTTTTAGGGAAAATGAGAAGG - Intronic
1126608737 15:50506993-50507015 CAGTTTTAGGCCAAGTGTGGTGG + Exonic
1126694937 15:51317853-51317875 AAGTGTCAGGAGAATTGAGATGG - Intronic
1126837431 15:52680412-52680434 AAGTATTAGGACAAGTCTAAGGG + Intronic
1127579893 15:60328474-60328496 AAGTTTTAGGTGAAGTGTAGGGG - Intergenic
1129023273 15:72543570-72543592 TAGTCTTAGGAGAAGTGATATGG + Intronic
1129058929 15:72844811-72844833 AACTTTTAGGAGACTTGTGCAGG + Intergenic
1130879534 15:88043192-88043214 GAGTCTTTGGAGAAGTCTGATGG - Intronic
1131627584 15:94138583-94138605 AAGTTTTAAAGGAAGTGAGAGGG + Intergenic
1133658141 16:7887157-7887179 CAATTTTAGGAGAAGTGTCAGGG + Intergenic
1133918472 16:10130719-10130741 AAGTTGCAGGAGAAGCGAGAAGG - Intronic
1135375249 16:21941072-21941094 AAGTTGCATGAGCAGTGTGAAGG - Intergenic
1138190153 16:55008062-55008084 AAGTTTTAGGTGGAGTGGCACGG - Intergenic
1138862669 16:60776982-60777004 AAGTTTTTGGAGATGTGTGACGG + Intergenic
1140053695 16:71506047-71506069 AAGTTTGTGGAGAAGTGTAATGG - Intronic
1140635986 16:76914425-76914447 AAGTTTTAGGAGATTTTTTATGG - Intergenic
1144041888 17:11419419-11419441 AAGTTTTAGGACAATTTGGAGGG + Intronic
1146190093 17:30757477-30757499 TATTTTTCTGAGAAGTGTGAGGG - Intergenic
1146334993 17:31961826-31961848 TACTTTTCTGAGAAGTGTGAGGG - Intronic
1147485060 17:40804962-40804984 AAGTTTAAGTAGATGAGTGATGG + Intergenic
1148144971 17:45358424-45358446 AATTTTTATGAATAGTGTGAGGG + Intergenic
1148399781 17:47346894-47346916 AAGTTTTAGTAGAATTTTGGAGG - Intronic
1148946088 17:51262590-51262612 AAGTGTTCGGAGAATTGTGCAGG - Intronic
1150440872 17:65190333-65190355 AAGATTCAGCAGAACTGTGAGGG + Intronic
1151035569 17:70794847-70794869 AGGTTTTGGCAGAAGTGTGAAGG + Intergenic
1151138415 17:71969537-71969559 GTATTTTAGGAGAAGAGTGAAGG + Intergenic
1153043593 18:836232-836254 CAGTTTTAGTAGAAGAATGAGGG + Intergenic
1153413198 18:4816862-4816884 AGGTTTTCAGAGAAGTTTGATGG + Intergenic
1153561262 18:6374127-6374149 AAGATGTAGCAGGAGTGTGAAGG - Intronic
1154378049 18:13825071-13825093 AAGTGTCAGGACAAGTGTTAGGG + Intronic
1158643234 18:59220546-59220568 GAGTTTTAGGAGAACGGGGAAGG - Intronic
1159067274 18:63584725-63584747 AATTTTTGGGAAAAGCGTGATGG + Intergenic
1159899230 18:74027592-74027614 AACTTTTAGGCCAGGTGTGATGG - Intergenic
1163940251 19:20485145-20485167 CAATTTTAGAATAAGTGTGATGG - Intergenic
1164426426 19:28145970-28145992 AGGATCTAGGAGATGTGTGAAGG - Intergenic
1165674300 19:37708113-37708135 AAGATTTTAGAGAAGAGTGAGGG + Intronic
1168356238 19:55701820-55701842 AAGTTGTAGAAGAAATGTCAGGG + Intronic
925541455 2:4972134-4972156 AAGTTCTAGGACTTGTGTGAGGG - Intergenic
925957121 2:8977826-8977848 AGGTTTTGGTTGAAGTGTGATGG - Intronic
926710556 2:15876109-15876131 TAGTTTTATGAGTACTGTGAAGG - Intergenic
927457777 2:23271991-23272013 AAGTTTTAGAAGAAATATCAAGG - Intergenic
929637618 2:43541248-43541270 ATGTTGTTGGAGAAGTATGAAGG - Exonic
929816214 2:45234228-45234250 AAGCTTTAGCATAAATGTGATGG + Intergenic
931117992 2:59185233-59185255 GAATTTTAGGAGAAATGTAAAGG + Intergenic
932870948 2:75397162-75397184 ATGATTTAGGGGAGGTGTGATGG - Intergenic
933033796 2:77366625-77366647 AAGTTTTAGGGGCAGTAAGAGGG - Intronic
933980978 2:87550514-87550536 AAGCTTCAGGAGAAGGGAGAAGG - Intergenic
936312853 2:111400271-111400293 AAGCTTCAGGAGAAGGGAGAAGG + Intergenic
938317344 2:130339336-130339358 ATGTTTTGGGACAAGTGTGGGGG - Intronic
938985220 2:136568960-136568982 AGGTTTTAGGACATGTGAGAGGG - Intergenic
939332924 2:140787861-140787883 ATGTTTTAGGTCAAGTGTGGTGG - Intronic
939447544 2:142329615-142329637 AAGTGTGAGAAGAAGAGTGATGG + Intergenic
939647245 2:144715810-144715832 ATGTTCCAGGAGAAGAGTGAGGG - Intergenic
939730760 2:145782041-145782063 AGATTATAGGAGAAGAGTGAAGG - Intergenic
940340833 2:152579176-152579198 AAGCTTGAGGAGAACAGTGAAGG - Intronic
941083078 2:161085371-161085393 AGGTTTGAGGAGTAGTCTGATGG - Intergenic
942308247 2:174629594-174629616 AAGTTTTAGGAGAGGTCTGGTGG + Intronic
943145861 2:184044023-184044045 AAGTTATAGAAGATGTGTAATGG + Intergenic
945852452 2:215025578-215025600 AAATATTATGAGAAGTGTTAAGG + Intronic
947785228 2:232812254-232812276 AAGTTTTAGTAAAAGAGTGAAGG + Intronic
1170155159 20:13262426-13262448 ATGTTTTAGGTGATGTGTGAAGG + Intronic
1171769876 20:29314092-29314114 ATGTGTTGGGAGAAGTGTCAAGG + Intergenic
1174613073 20:51815011-51815033 AGGTTTTAGGAGAACTCTGAGGG + Intergenic
1177130933 21:17254289-17254311 AATTTTTAGGAAGAGTGTGTAGG - Intergenic
1178873710 21:36396308-36396330 AGGTTTTATCATAAGTGTGATGG + Intronic
1179068254 21:38046793-38046815 AGGTTCTATAAGAAGTGTGATGG + Intronic
1179570668 21:42276910-42276932 AAGCTTCAGGAGAAGGATGAAGG + Exonic
1181840164 22:25650608-25650630 AAGTTTTACAAGAAGAGGGATGG + Intronic
1182226513 22:28802523-28802545 ATGTTTTGGGAGAAGTCTGGAGG + Intergenic
949438546 3:4055754-4055776 AATTTTTAGGCCAAGTGTGATGG - Intronic
949455056 3:4229407-4229429 AAGTCTTAGGAGAAATGACATGG - Intronic
949694500 3:6678814-6678836 TAATTTAAGGAGAAATGTGAAGG + Intergenic
951094934 3:18617885-18617907 AAGTTAAAGGAAATGTGTGAAGG - Intergenic
951169896 3:19528973-19528995 AAGTATTAAAAGAAGTTTGAAGG + Intronic
952660785 3:35844178-35844200 AATAATTAGGAGAAATGTGATGG - Intergenic
953228284 3:41040990-41041012 AAGTTTTCAGAGAGGTGTGGAGG + Intergenic
953285868 3:41608608-41608630 ATGTTTTGGGAGTAGTGTGATGG + Intronic
954601181 3:51871026-51871048 AAATTTTAGGACAGGTGTGGTGG - Intergenic
955695211 3:61629053-61629075 AAGTTTAGGGAGAAGTAGGAGGG + Intronic
956173833 3:66454782-66454804 AAGTTTTGGGAGAAAGGTGAGGG - Intronic
957195406 3:77061232-77061254 ATTTATTAGGAGAAGTCTGAAGG + Intronic
957231565 3:77523948-77523970 AAGTTGCAGGAAAGGTGTGAGGG + Intronic
958145525 3:89618992-89619014 CAGTTTTAGGACTAGTGTGAGGG + Intergenic
958529274 3:95305060-95305082 AGGTTTAAGGACAAGAGTGATGG + Intergenic
959550301 3:107648277-107648299 AAGTTTTAGGAAAAGTTGTAAGG - Intronic
959936567 3:112035531-112035553 AATTTTGAAGAGAAGAGTGAGGG + Intronic
960864563 3:122185837-122185859 AAGATGTAGGAGAAGTTGGAGGG + Intronic
961903766 3:130241367-130241389 AAGTTTGAGGAGAGAGGTGAGGG - Intergenic
963690010 3:148487604-148487626 AAGTATTAGTACAAGTCTGAAGG - Intergenic
963914335 3:150843745-150843767 AAATTTTAGTAGAAGTCTAATGG - Intergenic
964517997 3:157533586-157533608 ATTGTTTAGGAGAAGAGTGAAGG - Intronic
964948911 3:162262763-162262785 AAGGTTTAGGGGAAATGGGATGG + Intergenic
965322612 3:167267440-167267462 AAGTATTATGAGAAGTGAAAAGG + Intronic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
969957060 4:10901866-10901888 AAGTTTCAGGACATGTGTGCAGG + Intergenic
970460429 4:16269513-16269535 GACCTTTAGGAGAAGTGAGATGG + Intergenic
971536376 4:27756455-27756477 AAGATTTAGGAGAGGTGCCAAGG - Intergenic
971603610 4:28628226-28628248 AAGTTTTAAGAAAAGTTTTAAGG - Intergenic
972508254 4:39742093-39742115 ATCTCTTAGGAGCAGTGTGAGGG - Intronic
973562316 4:52149476-52149498 AAGTTTTAGGCCAGGTGTGATGG - Intergenic
974517260 4:62933851-62933873 AAGTTTTAGGAGACATTTAAGGG - Intergenic
974618481 4:64323110-64323132 TAATTTTAGGACAGGTGTGAAGG + Intronic
977441855 4:97077589-97077611 AAGATGTAGGAGAACTGTAATGG - Intergenic
977484024 4:97619071-97619093 TAGTTTTAGGGGAAATGAGAAGG - Intronic
977733934 4:100389124-100389146 AAGTTTTAAGAAATGTGTGTGGG - Intergenic
979462445 4:120999457-120999479 CAGCTTTAGAATAAGTGTGATGG + Intergenic
980379474 4:131993126-131993148 AAGTTTTCAGAGGATTGTGAAGG - Intergenic
980765165 4:137293222-137293244 AATTTTTAGCAAAAGTGTGGAGG - Intergenic
981087759 4:140701455-140701477 AAGTTTTAAAAGAAGCGTTAGGG - Intronic
981570028 4:146142114-146142136 CAGTTCTAGGAGTAGTGAGATGG - Intergenic
982078012 4:151757971-151757993 AATTTTTAAGAAAAGTATGAAGG - Intronic
982514816 4:156331839-156331861 AATTTTTAAGAGAAATGTCATGG - Intergenic
982684980 4:158477301-158477323 AAGTCTGAAGAGATGTGTGAGGG - Intronic
983759753 4:171391120-171391142 AAGAGTTGGGAGAAGTCTGAAGG - Intergenic
984262752 4:177461665-177461687 TAATTTTAGGAGAATTGGGAAGG + Intergenic
984816228 4:183839357-183839379 AACTTTTCGGATCAGTGTGATGG - Intergenic
984916337 4:184728310-184728332 AAGTTTTAAGAGAATTTTGAAGG - Intronic
986438021 5:7753970-7753992 AAGTTTTAAAACAATTGTGAGGG + Intronic
987170561 5:15253011-15253033 ATGTATTAGGAGAGGTGTGACGG + Intergenic
988459652 5:31422547-31422569 AAGTTTTAGGAGAAGTGTGAAGG - Intronic
991554337 5:67878192-67878214 AAGTTTTAGTCCAAGTCTGAAGG - Intergenic
992444674 5:76822942-76822964 AAGTTTTAGGCCAAGCGTGGTGG + Intronic
992741452 5:79777482-79777504 AAATTTTAGGCCAGGTGTGATGG + Intronic
992768579 5:80026160-80026182 AAATTTCAGGAGAAGTAGGAGGG - Intronic
995693991 5:114859199-114859221 AAGTAATAGGAGAAGTGTCAGGG + Intergenic
996845175 5:127890989-127891011 AAGTTTGAAGAGAAGTGTGAGGG - Intergenic
997115289 5:131120267-131120289 CAATTTTAGAATAAGTGTGATGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1000483709 5:161812187-161812209 CAGTTTCAGGAGAAGTTTGCAGG - Intergenic
1000785741 5:165541172-165541194 AAGTTTTAGGAACAGAGAGAGGG + Intergenic
1002085477 5:176772439-176772461 AAGTTTCAGGTCAAGTTTGAAGG + Intergenic
1003812927 6:9804752-9804774 ATGTTTCAGGAGAAGAATGACGG - Intronic
1005797986 6:29387861-29387883 AAATTTTGGTAGAAGAGTGAGGG - Intronic
1007818945 6:44545741-44545763 AAGTGTTGGGAGAAGTCTGGGGG - Intergenic
1007895624 6:45354710-45354732 AAGTTTTAGGCCAGGTGTGGTGG + Intronic
1008862162 6:56161919-56161941 GAGTTTTAGGAGATGAGTGCGGG - Intronic
1009758669 6:67975874-67975896 ATGTTCTAGGAAAAGTGTTAAGG + Intergenic
1009843794 6:69110568-69110590 AACTTTCAGGAGAAATGTTAAGG - Intronic
1011003211 6:82614834-82614856 AAGTATGAGGAAAAGTGTGGAGG + Intergenic
1011626398 6:89286951-89286973 ACATTTTAGGAGAAATGGGATGG - Intronic
1012411225 6:98959751-98959773 AAGAGGTAGGAGAAGTTTGAAGG - Intergenic
1012684305 6:102225276-102225298 AAGTTTTAGGAGGAGGTTGTAGG - Intergenic
1012811377 6:103963517-103963539 AAGTATTAGGAAAATTGTGATGG + Intergenic
1013777117 6:113690566-113690588 AAGTTTTAAGAAATGTATGATGG + Intergenic
1014628712 6:123762577-123762599 AAGTTTTAGGAGGAAAATGAGGG + Intergenic
1017444432 6:154494485-154494507 AAGTTTTAATAGAACTGTCAAGG + Intronic
1017836253 6:158181300-158181322 CAATTTTAGAATAAGTGTGATGG + Intronic
1017923055 6:158887901-158887923 AAGTTTAAAGAGAAGTGTAGAGG + Intronic
1019794744 7:3041363-3041385 AAGAATTAGGAGGAGTGGGAAGG - Intronic
1020768300 7:12353703-12353725 TAGTTTAAGGAGCAGTGTGTAGG - Intronic
1020836551 7:13159762-13159784 AAATGTGAGGAGAAGGGTGATGG + Intergenic
1021099794 7:16574765-16574787 AAGTTTTAGGATATATGTGCAGG - Intronic
1022162994 7:27730847-27730869 AAACTTTAGTAGCAGTGTGAAGG + Intergenic
1022730328 7:33016893-33016915 AAGTTTTAGGCTATGTGTGGTGG + Intronic
1022952531 7:35352127-35352149 AAGTTTTAGCTTCAGTGTGAAGG + Intergenic
1023889051 7:44379919-44379941 TAGTTTTAGCAGAGGTGTGAAGG + Exonic
1024190611 7:47003418-47003440 AAGTGTTAGGAGGATTGTAAAGG - Intergenic
1024388291 7:48778674-48778696 ATGTTTTAGTACAAGTCTGAAGG + Intergenic
1025981289 7:66409035-66409057 AAGTTTTAGGCCAGGTGTGGTGG - Intronic
1026423432 7:70264853-70264875 AATTTTTAGAAAAAGTGTAAAGG + Intronic
1027514153 7:79121056-79121078 AAGTTATAGAAGAAATGTGGGGG - Intronic
1028019630 7:85753870-85753892 CAATTTTAGAATAAGTGTGATGG - Intergenic
1029857719 7:103535219-103535241 AAGTTTAATGAGATATGTGAGGG - Intronic
1030419849 7:109294955-109294977 AAGTTTTAGGGAAAATGTAAGGG - Intergenic
1030690580 7:112528500-112528522 AAGTTTTATTAGGGGTGTGATGG - Intergenic
1031626416 7:123997537-123997559 AAGCTGTAGGAGATTTGTGAAGG + Intergenic
1032223932 7:130015435-130015457 AGGATTTAAGGGAAGTGTGAGGG - Intergenic
1033439118 7:141362796-141362818 AAGTTACAGGAGAAGTGGAAAGG + Intronic
1033963810 7:146948938-146948960 AGGCTTTAGGGGAAGTGTGATGG + Intronic
1034841966 7:154406682-154406704 AAGTTCCAGGAGAAGGCTGATGG - Intronic
1037307367 8:17519661-17519683 AAGTTAGAGAAAAAGTGTGAAGG - Intronic
1039821734 8:41140989-41141011 AAATTTCAACAGAAGTGTGAGGG + Intergenic
1040968553 8:53109908-53109930 CAGTTTTCGAATAAGTGTGATGG + Intergenic
1041648574 8:60279084-60279106 AAGTGGTAGGAGAAGTTTCATGG + Intronic
1041995633 8:64053749-64053771 AAGTTTTAAGATAAGCGTTAAGG - Intergenic
1042019566 8:64356854-64356876 ATGTTTTATGAGAGGTGTGCAGG - Intergenic
1042613411 8:70622562-70622584 AAGTTTTACCAGAAGTGTTCTGG - Intronic
1042714691 8:71759812-71759834 AAGATTTAGAAGAATTTTGAAGG + Intergenic
1042975745 8:74467183-74467205 AAGTTTGAGGAGAAAGGAGAAGG + Intronic
1043066311 8:75575647-75575669 AAGTTTTGGGATAAATGTGCAGG + Intergenic
1043595689 8:81882126-81882148 AAATTTAAGAAGAAGAGTGAAGG + Intergenic
1043840645 8:85099677-85099699 AAGTTTTAGGACAATTGATATGG + Intergenic
1044918156 8:97137977-97137999 CAGTCTGAGGAGAAGTGAGAGGG - Intronic
1047038579 8:120967334-120967356 AAGTGTTAGGAGACATTTGATGG + Intergenic
1049504061 8:142985488-142985510 AAGCGTCAGGACAAGTGTGAAGG + Intergenic
1049956685 9:699477-699499 AAGATGTAGGAGTAGTGTGCAGG + Intronic
1050747450 9:8893039-8893061 AAGTTTTCTAAGAAGTTTGATGG + Intronic
1051021114 9:12544105-12544127 GAGTGCTAAGAGAAGTGTGAGGG - Intergenic
1052186802 9:25607416-25607438 AATTTTTACAAGAAATGTGAAGG - Intergenic
1052986876 9:34494291-34494313 ACATTTTAGGGGAAGTTTGAGGG + Intronic
1053800834 9:41763691-41763713 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1054144361 9:61551149-61551171 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1054189265 9:61975841-61975863 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1054649252 9:67612771-67612793 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1054908362 9:70430701-70430723 AAGTTTTAGTAGATGAGTGGGGG + Intergenic
1055678784 9:78693104-78693126 AAGTTTCAGGAGAGCTGTCATGG - Intergenic
1055854641 9:80670768-80670790 AAGTTTTAGAAGTAGGGAGAGGG - Intergenic
1055889134 9:81104365-81104387 TATTTTTATGAGAAGCGTGAAGG - Intergenic
1056433324 9:86550266-86550288 CAGTTTCAGGAAAACTGTGATGG + Intergenic
1056551629 9:87657891-87657913 AAGTTTCAGGAGAAGGGAGATGG + Intronic
1057080818 9:92173211-92173233 AGGTTTGAGGAGGAGTTTGAGGG + Intergenic
1057503831 9:95616661-95616683 AAGTTGTAGGAGAGGTGAGAGGG - Intergenic
1057827614 9:98382866-98382888 TAGTTTTAGTGGAAGTGTGAAGG - Intronic
1058430772 9:104917093-104917115 AAGTTCTAGGAAAGGTGTTATGG + Intronic
1059534766 9:115070385-115070407 AAGCTTAAGGAACAGTGTGAAGG + Intronic
1059684539 9:116622260-116622282 AACTTCCAGGAGAAATGTGATGG - Intronic
1060687816 9:125627572-125627594 AAGAGTTAGGTGAAGTGTGCTGG - Intronic
1186289638 X:8082590-8082612 ATGTTTTTGGAGAAGTGTATGGG - Intergenic
1186457600 X:9722255-9722277 AAGTTCTTGAAGAAGTGAGAAGG - Intergenic
1187357917 X:18595520-18595542 AAATTTTAGGAGATGTGGAATGG + Intronic
1187413603 X:19072781-19072803 ATGTTTTTGGAGAAGTTTTATGG + Intronic
1189104980 X:38226190-38226212 AAGTTTAAGGGGAAATGTGGTGG + Intronic
1190061740 X:47216024-47216046 AGGTTTGAGTAGAAGAGTGAGGG - Intergenic
1192636886 X:72828635-72828657 CAGTTTTAGAATAAGTGCGATGG + Intronic
1192644828 X:72892179-72892201 CAGTTTTAGAATAAGTGCGATGG - Intronic
1193414275 X:81202505-81202527 AAGTTTTGGGAGATGGGAGATGG + Intronic
1193511985 X:82413611-82413633 TAGTTTTAGGAGTCGTGGGAAGG - Intergenic
1194317901 X:92404758-92404780 GAGTTTAAGAAGAACTGTGAGGG + Intronic
1194702719 X:97134115-97134137 CAGTTTTAGGTGAAGGATGAAGG + Intronic
1197646093 X:129018448-129018470 AGTTTTTTGGAGAAGTTTGAGGG + Intergenic
1198407951 X:136333802-136333824 AATTTTTAGGCCAAGTGTGGTGG - Intronic
1199091447 X:143697682-143697704 AGGTTTCAGGTGTAGTGTGATGG + Intergenic
1199492140 X:148412156-148412178 AAGTTTTAGCAGCAGGGCGAAGG - Intergenic
1200626075 Y:5518054-5518076 GAGTTTAAGAAGAACTGTGAGGG + Intronic