ID: 988461735

View in Genome Browser
Species Human (GRCh38)
Location 5:31445002-31445024
Sequence CAATTTTTGTGGAGGCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988461730_988461735 -4 Left 988461730 5:31444983-31445005 CCGTGTCAGCCATTGCTGGCAAT 0: 1
1: 1
2: 2
3: 6
4: 132
Right 988461735 5:31445002-31445024 CAATTTTTGTGGAGGCCAGTGGG No data
988461726_988461735 29 Left 988461726 5:31444950-31444972 CCTGATATATGAAGGAGATATTG 0: 1
1: 0
2: 10
3: 143
4: 763
Right 988461735 5:31445002-31445024 CAATTTTTGTGGAGGCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988461735 Original CRISPR CAATTTTTGTGGAGGCCAGT GGG Intronic
No off target data available for this crispr