ID: 988466274

View in Genome Browser
Species Human (GRCh38)
Location 5:31495683-31495705
Sequence GGTACCAGAGGGACACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988466265_988466274 25 Left 988466265 5:31495635-31495657 CCTCCAAAATACCATGAACTTGG 0: 1
1: 0
2: 1
3: 20
4: 179
Right 988466274 5:31495683-31495705 GGTACCAGAGGGACACCCACTGG 0: 1
1: 0
2: 2
3: 9
4: 110
988466268_988466274 14 Left 988466268 5:31495646-31495668 CCATGAACTTGGTAAATGAGCAA 0: 1
1: 0
2: 1
3: 14
4: 180
Right 988466274 5:31495683-31495705 GGTACCAGAGGGACACCCACTGG 0: 1
1: 0
2: 2
3: 9
4: 110
988466267_988466274 22 Left 988466267 5:31495638-31495660 CCAAAATACCATGAACTTGGTAA 0: 1
1: 0
2: 1
3: 20
4: 220
Right 988466274 5:31495683-31495705 GGTACCAGAGGGACACCCACTGG 0: 1
1: 0
2: 2
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988466274 Original CRISPR GGTACCAGAGGGACACCCAC TGG Intronic
900503458 1:3017692-3017714 GGTACCCGTGTGAGACCCACAGG - Intergenic
905891647 1:41521927-41521949 GCCACCACAGGGCCACCCACAGG + Intronic
906566694 1:46806006-46806028 GGTCCCAGAGGGAGACCCATGGG + Intronic
907325786 1:53637965-53637987 GGGACCAGCTGGACACCCATGGG + Intronic
913066490 1:115260718-115260740 GGGACATGAGGGAAACCCACAGG + Intergenic
915784519 1:158595137-158595159 GGTACCAGAGGAATACACTCAGG - Intergenic
921976418 1:221207661-221207683 CATCCCAGAGGGGCACCCACTGG - Intergenic
924790079 1:247238082-247238104 GGGAACAGAGGGAGAACCACAGG - Intergenic
924929943 1:248721750-248721772 GGTACAAGGGAGACATCCACAGG - Intronic
1064123458 10:12638881-12638903 GGGATGAGAGGGACACCAACGGG - Intronic
1069820992 10:71228729-71228751 AGCACCCGAGGGGCACCCACGGG + Intronic
1069821477 10:71231191-71231213 GGTGCCATTGTGACACCCACTGG + Intronic
1076061522 10:127417410-127417432 GGTCCCTGAGAGACACGCACTGG + Intronic
1076510053 10:131006965-131006987 GGTGCCAGTGGGATACCCTCAGG + Intergenic
1076812344 10:132893919-132893941 GTTACCAGTGGCAAACCCACAGG - Intronic
1076812361 10:132894011-132894033 GTTACCAGTGGCAAACCCACAGG - Intronic
1077231381 11:1459515-1459537 GGGACCAGCGGGACCCTCACTGG - Intronic
1080695610 11:34600708-34600730 GGACCCAGAGGCACAGCCACTGG - Intergenic
1084082112 11:66834422-66834444 GGTACAAGAGTGGCACCCAGTGG + Intronic
1084149716 11:67282425-67282447 GCTCCCACAGGGGCACCCACGGG + Exonic
1084456388 11:69270289-69270311 GGTACCGGAGGGAGTCCCACAGG + Intergenic
1085301766 11:75462871-75462893 GGAACCAGAGGCGCTCCCACTGG + Exonic
1086342317 11:85858603-85858625 GGTACAAGGGAGACAGCCACAGG + Intronic
1089461257 11:118655715-118655737 GGGGCCAGAGGGACAGCCATGGG + Intronic
1092703338 12:11257095-11257117 TGTCCCAGAGGGGCACCCAGCGG - Intergenic
1093816499 12:23555312-23555334 GCTTTCAGAGAGACACCCACAGG - Intronic
1097154734 12:57004486-57004508 GGTACCAGAGTGGCTCTCACTGG + Exonic
1097221673 12:57454898-57454920 GGCCCCAGAGGAATACCCACTGG + Intronic
1100456211 12:94754016-94754038 GCTACCAAGGGGACACACACAGG + Intergenic
1104108700 12:125686789-125686811 GGTTCCAGAGGCACAATCACTGG - Intergenic
1104259560 12:127170462-127170484 GGGACCATATAGACACCCACTGG + Intergenic
1105604011 13:21911924-21911946 GGCCCCAGAGGGACACCCAATGG - Intergenic
1115411804 14:33083785-33083807 GGTACCACTGGGACCCCCAGAGG + Intronic
1117089284 14:52234065-52234087 GGCACCAGACAGACAGCCACGGG - Intergenic
1117104355 14:52382915-52382937 CATCCCAGAGGGGCACCCACTGG - Intergenic
1122083007 14:99279896-99279918 GGTAGCAGGGGGACCCCCAAAGG + Intergenic
1202848446 14_GL000225v1_random:1097-1119 GGGAGCAGGGTGACACCCACAGG - Intergenic
1202864296 14_GL000225v1_random:105051-105073 GGGAGCAGGGTGACACCCACCGG + Intergenic
1127574682 15:60279451-60279473 GGTCCCTGTGGGACACCCAGTGG + Intergenic
1129110160 15:73332492-73332514 GGTCCCAGAGGGACATCTCCTGG + Intronic
1130214105 15:81952515-81952537 TGTCCCAGAGGGAGAACCACTGG - Intergenic
1131953460 15:97706215-97706237 GGGACCAGAGGTACACCCAAAGG + Intergenic
1132760860 16:1508060-1508082 GGTCACAGAGGGACCCCAACAGG - Intronic
1137729497 16:50679453-50679475 GGTCCCTGAGGGCCGCCCACTGG - Intronic
1148226618 17:45902554-45902576 GGTATCAGAAGAACACCTACTGG + Intronic
1151259094 17:72902765-72902787 GAAACCAGAGGGGTACCCACTGG - Intronic
1151625367 17:75272390-75272412 CAGAGCAGAGGGACACCCACAGG - Intergenic
1151855477 17:76718550-76718572 GGTAGCAGAGGGAAAGCTACTGG + Intronic
1160242285 18:77132560-77132582 CGTCCCCGAGGGTCACCCACCGG + Exonic
1162063647 19:8111598-8111620 GGCCCTAGAGGGACAGCCACGGG - Intronic
1162968592 19:14167275-14167297 GGGACGAGGGGGACACACACAGG + Intronic
1163320442 19:16571789-16571811 GGTAGGGGAGGGACACGCACGGG - Intronic
1163426079 19:17241661-17241683 GGTTCCAGCTGGACACCCAGGGG + Intronic
1163632938 19:18426339-18426361 GGTACCAGAGGGCCAGCCTGAGG - Intronic
1164617987 19:29678015-29678037 GGGACCACAGGCACACCCAATGG + Intergenic
1165520613 19:36311298-36311320 AGTAACAGAGGGACACGCAGAGG + Intergenic
1165623458 19:37267286-37267308 AGTAACAGAGGGACACGCAGAGG - Intergenic
1166993353 19:46706317-46706339 GGTACCAGAAGGGCTCCCAAAGG - Intronic
1167297827 19:48662136-48662158 GATACCAGAAGCCCACCCACCGG - Intronic
927708300 2:25310490-25310512 GGTGCCAGGGGGACACACACAGG + Intronic
928416754 2:31099494-31099516 AGTACCAGAAGGAAACACACAGG - Intronic
928617870 2:33057365-33057387 GGCCCCAGTGGGAGACCCACTGG - Intronic
930476810 2:51892079-51892101 CGTCCCAGAGGGGCACCCGCTGG - Intergenic
931672783 2:64663726-64663748 GGTACCAGAAGGAGACCAATGGG + Intronic
935545298 2:104394755-104394777 GGTACAAGGGAGACAGCCACAGG - Intergenic
940054455 2:149499591-149499613 CATCCCAGAGGGGCACCCACCGG + Intergenic
940637747 2:156319482-156319504 GGTACTAGAGGGACTTCCAGAGG - Intergenic
944866975 2:203871909-203871931 GGCACCAGAGTGGCACCCAGAGG - Intronic
947533509 2:230927299-230927321 GGTATCCAAGGGATACCCACAGG - Intronic
948355260 2:237372627-237372649 GGGACCCGAGGGTCAGCCACTGG + Intronic
1169534812 20:6526217-6526239 GGTACATGAGGGACCCCCAATGG - Intergenic
1173626747 20:44478458-44478480 GGATCTAGAGGGACAGCCACTGG + Intronic
1175813944 20:61873942-61873964 GGTCCCCGCAGGACACCCACAGG + Intronic
1177763849 21:25434218-25434240 CCTCCCAGAGGGGCACCCACTGG - Intergenic
1181553143 22:23652453-23652475 AGTACCCAAGGGACACCCAGGGG - Intergenic
1183269504 22:36851841-36851863 GGAACCAGAGGTAGACCCTCAGG + Intergenic
1184250862 22:43259492-43259514 GGTACCAGAGGGAAGTCAACTGG + Intronic
1185363429 22:50423085-50423107 GGCCGCAGAGGGACCCCCACTGG + Intronic
949156945 3:839223-839245 AGAATCAGAGGGACACACACAGG + Intergenic
950366461 3:12488663-12488685 GGCCCCAGAGGGACACGTACTGG + Intronic
965757802 3:172041949-172041971 GATACCAGAGGGGCACCCACAGG + Intronic
966735167 3:183181770-183181792 GGGACCATAGAGCCACCCACTGG + Intronic
967171209 3:186824952-186824974 GGGACCACAGAGCCACCCACTGG - Intergenic
968730257 4:2266068-2266090 GGCACCATAGGGACTCCCCCTGG - Intergenic
968896220 4:3405348-3405370 GGTCCCAGAGGGACACCGCATGG + Intronic
977500344 4:97829136-97829158 CGTCCCAGAGGGGCACCCACCGG - Intronic
987379590 5:17272631-17272653 GGTATCAGAGGGACGCTCATAGG - Intronic
988466274 5:31495683-31495705 GGTACCAGAGGGACACCCACTGG + Intronic
989624952 5:43420364-43420386 GAGAGCAGAGGGTCACCCACCGG - Intergenic
990494840 5:56337130-56337152 TGTACCTGAGGGGCACCCTCTGG - Intergenic
997207753 5:132059931-132059953 GCTACCAGAGGGACTGCCAGGGG + Intergenic
997512877 5:134465531-134465553 GGTACCACCAGGAGACCCACTGG + Intergenic
999846259 5:155484013-155484035 GGTAGCTGAGGGACACAGACAGG + Intergenic
1001200455 5:169711329-169711351 GGTACCAGTGGGTCATTCACTGG + Intronic
1013255339 6:108379635-108379657 GGTACCTCATGGTCACCCACTGG - Intronic
1013964295 6:115936105-115936127 CGTCCCAGAGGGGCACCCACTGG - Exonic
1019306613 7:338487-338509 AGTCCCAGAGGGACACCCAGAGG - Intergenic
1019569688 7:1705082-1705104 GAGAACAGAGGGACACCCAGTGG + Intronic
1022499555 7:30873938-30873960 GGCCGCAGAGGGACCCCCACTGG - Intronic
1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG + Intergenic
1034191191 7:149214640-149214662 GGTAACATAGTGAGACCCACAGG + Intronic
1034547099 7:151796308-151796330 GGGCCCAGTGAGACACCCACAGG + Intronic
1034922992 7:155099012-155099034 GGCACAAAAGGTACACCCACAGG - Intergenic
1035404009 7:158587053-158587075 GGTTCCAGCGCGACACCCCCAGG - Intronic
1035729175 8:1842507-1842529 GGTCCCTGAGTGTCACCCACAGG - Intronic
1041075255 8:54163474-54163496 GGTACCTGAGGGACAGGCAGAGG + Intergenic
1045857655 8:106782577-106782599 GGTACCTGTAGGACATCCACGGG + Intergenic
1049514780 8:143048380-143048402 GCTACCAGAGGGACAGCAAACGG - Intronic
1052864568 9:33457195-33457217 GGCTCCAGAGGGACCCCCATAGG + Intergenic
1056321842 9:85442670-85442692 GGTGCCAGAAGCACACCTACAGG + Intergenic
1057715035 9:97486404-97486426 GGCACCAGAAGGAAATCCACAGG - Intronic
1059374609 9:113872531-113872553 GGTCCGGGAGGGACACCCACAGG - Intergenic
1062633991 9:137480426-137480448 GGCAGCAGGAGGACACCCACAGG - Exonic
1203740027 Un_GL000216v2:170965-170987 GGGAGCAGGGTGACACCCACCGG - Intergenic
1185596200 X:1308501-1308523 GGTGGGAGAGGGCCACCCACGGG - Intronic
1188848422 X:35102742-35102764 GGTACCAGCAGGAGACCCAAAGG + Intergenic
1190913231 X:54790749-54790771 GGCACTAGAGGGAAACCCAGTGG + Intronic
1193382077 X:80827548-80827570 CCTCCCAGAGGGGCACCCACCGG + Intergenic
1195168191 X:102240500-102240522 GTTTCCAGAGAGACGCCCACGGG - Intergenic
1195190666 X:102446587-102446609 GTTTCCAGAGAGACGCCCACGGG + Intronic
1196053970 X:111335190-111335212 ACTAACAGAGGGACACTCACAGG - Intronic
1201328727 Y:12795949-12795971 CGAACCAGAGCGACTCCCACAGG - Intronic