ID: 988469995

View in Genome Browser
Species Human (GRCh38)
Location 5:31528819-31528841
Sequence CGCTGTCAGGGCAGCGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988469991_988469995 -8 Left 988469991 5:31528804-31528826 CCTCGGAACTGCAAGCGCTGTCA 0: 1
1: 0
2: 0
3: 6
4: 45
Right 988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 115
988469988_988469995 11 Left 988469988 5:31528785-31528807 CCTTTAATGTCTGCCTGCACCTC 0: 1
1: 0
2: 2
3: 19
4: 174
Right 988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 115
988469987_988469995 14 Left 988469987 5:31528782-31528804 CCACCTTTAATGTCTGCCTGCAC 0: 1
1: 0
2: 2
3: 8
4: 153
Right 988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 115
988469990_988469995 -2 Left 988469990 5:31528798-31528820 CCTGCACCTCGGAACTGCAAGCG 0: 1
1: 0
2: 0
3: 1
4: 63
Right 988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 115
988469986_988469995 21 Left 988469986 5:31528775-31528797 CCTAATTCCACCTTTAATGTCTG 0: 1
1: 0
2: 2
3: 20
4: 240
Right 988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988469995 Original CRISPR CGCTGTCAGGGCAGCGCTCT GGG Intronic
903849508 1:26297522-26297544 TCCTGTCTGGGCAGGGCTCTGGG - Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
907289123 1:53401656-53401678 TGCTGTCAGGGCCACACTCTCGG - Intergenic
907884034 1:58576981-58577003 CGCTGCCAGTGCCGCGCGCTGGG - Exonic
911664219 1:100535802-100535824 CCCTGTCAGGCCAGCGCTAAGGG + Intergenic
912551036 1:110485439-110485461 GGCTCTCAGGGCAGTGCTCTTGG + Intergenic
912836114 1:112997956-112997978 CTCTGTCAGGGAAGCTCTCAGGG - Intergenic
913533411 1:119749125-119749147 TGCTGTCAGTGCAGTGCTCATGG - Intronic
914852797 1:151327366-151327388 CGCTGTCAGGGAAGCGCAGGCGG - Exonic
923666749 1:236004831-236004853 GGCTGTCAGGGCATCACACTGGG + Intronic
1062788897 10:288836-288858 CGCTGTCTTGGGAGGGCTCTCGG - Intronic
1067459579 10:46447811-46447833 CCCTTCCAGGGCAGCGCACTGGG + Intergenic
1067627609 10:47936802-47936824 CCCTTCCAGGGCAGCGCACTGGG - Intergenic
1070197935 10:74176381-74176403 CGCTGTCAGGGCAGGTCTTCGGG - Intronic
1075745323 10:124723602-124723624 AGCTGTTAGGGCAGGGCCCTGGG - Intronic
1078147979 11:8735217-8735239 CGGTGTCAGGGCAGCATTCCAGG - Intronic
1081730910 11:45371171-45371193 GGGTGTCAGGGCTGCGCTCCAGG - Intergenic
1083276823 11:61601606-61601628 TGCTGACAGGGCAGGGATCTGGG + Intergenic
1085574379 11:77589600-77589622 CGCGGTCGACGCAGCGCTCTTGG - Intronic
1093741774 12:22697096-22697118 CTGTCTCAGTGCAGCGCTCTAGG + Intergenic
1094818871 12:34209780-34209802 CGCTGGCAGGGCTGGCCTCTTGG - Intergenic
1096878573 12:54648806-54648828 TGCTGTGAGGGCAGCCCCCTAGG - Intergenic
1097180825 12:57170968-57170990 CCCTCTCAGGGCAGGGCTCAAGG - Intronic
1104331935 12:127855197-127855219 AGCTATCAGGGCAGAGCTCATGG + Intergenic
1104674044 12:130700655-130700677 CGCTGGCAGGGCTGTGCTCCAGG - Intronic
1104906354 12:132215508-132215530 CCCTGGCATGGCAGCGCTCTTGG - Intronic
1113043547 13:106129485-106129507 AGCCTTCAGGGCAGAGCTCTTGG + Intergenic
1113866492 13:113529320-113529342 CGCTGTCATCCCAGCGCTTTGGG + Intronic
1114620615 14:24094200-24094222 CGCTGGCAGGCCAGCTCCCTCGG - Exonic
1117751249 14:58925700-58925722 CTCTGTCAAGGCAGGGCTGTTGG - Intergenic
1121109735 14:91303934-91303956 CGCGGTGAGCGCTGCGCTCTGGG + Exonic
1121648119 14:95535018-95535040 CGCGGGCCGGGGAGCGCTCTGGG + Exonic
1122787620 14:104171233-104171255 CGCTGTCAGGGGAGCCATCCAGG - Intronic
1202859692 14_GL000225v1_random:73329-73351 GGCTGTCAGGGCAGGCCTCCTGG - Intergenic
1132783596 16:1642143-1642165 GGCTGCAAGGGCAGGGCTCTTGG - Intronic
1134405778 16:13957491-13957513 CGCCCCCGGGGCAGCGCTCTAGG - Intergenic
1136396410 16:29994916-29994938 AACTGTCAGGGCAGGGCTCGAGG - Intronic
1138651658 16:58464376-58464398 CGGCGTCGGGGCAGCGCGCTCGG - Exonic
1139088579 16:63617567-63617589 CGCTGTGGGGGCACCTCTCTGGG - Intergenic
1139395484 16:66635444-66635466 CCCTGTCAGGGCTGCTCTCCTGG - Intronic
1140727056 16:77822899-77822921 AGCTGCCAGGGCAGCTCTGTCGG - Intronic
1141646341 16:85370034-85370056 AGCTGGGAGGGCAGCCCTCTAGG + Intergenic
1143558100 17:7675056-7675078 CGCTATCTGAGCAGCGCTCATGG + Exonic
1143844908 17:9766693-9766715 GGCTCTCAGGGCAGGGCTCACGG - Intergenic
1146798781 17:35801892-35801914 CCCTGGCAGGGCCGCTCTCTAGG + Intronic
1147990700 17:44331077-44331099 CGCTGTCCCAGCAGAGCTCTGGG - Intergenic
1149466488 17:56884195-56884217 CACTCTCAGGGAAGGGCTCTAGG - Intergenic
1152263288 17:79278620-79278642 CGCTGGCAGGGCAGATCTCCAGG - Intronic
1152798084 17:82317697-82317719 TGCTCTCAGGGCAGCTCTCAGGG - Intergenic
1152961409 18:82543-82565 CTCTGGCAGGCCAGAGCTCTGGG + Intergenic
1153531410 18:6050300-6050322 CGATGTCAGGGAAACGCTTTAGG + Intronic
1158869968 18:61676700-61676722 CTCTGTCTGGGCAGCGGGCTAGG - Intergenic
1160881566 19:1323225-1323247 CCCTGGCAGGGCAGGACTCTGGG + Intergenic
1161424173 19:4193350-4193372 GGCTGTCAGAGAAGGGCTCTTGG + Intronic
1161571020 19:5030966-5030988 ACCTGTCAGGGCAGCCCTCTGGG - Intronic
1162926676 19:13933697-13933719 CGATGTCAGTGCAGGGCTGTGGG + Intronic
1165017087 19:32889276-32889298 GGATGTCTGGGCAGGGCTCTTGG - Intronic
1165036569 19:33037941-33037963 AGCTGTCATCGCAGCACTCTGGG + Intronic
926700372 2:15799444-15799466 CTCTCTCAGTGCAGGGCTCTGGG + Intergenic
927870074 2:26617802-26617824 CGAACTCAGGGCAGCCCTCTGGG - Intronic
933216772 2:79639174-79639196 CTCTGTGAGGGCTGCCCTCTTGG + Intronic
935135671 2:100298874-100298896 CGTGGTCAAGGCAGCGCTCAAGG + Exonic
937599826 2:123718044-123718066 CGCTGTCAGAGCAGCAGTCCTGG - Intergenic
942653754 2:178194415-178194437 CGCTGGCGGGGCGGCGCTCCGGG - Intergenic
949031315 2:241798766-241798788 AGCTGACAGGGCCGCGCTCCTGG - Intronic
1171492558 20:25531746-25531768 CGCTGTCTGGGAAGCCCTCCTGG - Intronic
1179051159 21:37889532-37889554 CTTTGTCATGGCAGCCCTCTAGG - Intronic
1180701032 22:17781553-17781575 GGCTGTCAGGGCAGAGCCCTGGG - Intergenic
1180732028 22:17989279-17989301 TGCAGTCAGGGCAAGGCTCTGGG + Intronic
1181391758 22:22588178-22588200 GGGTCTCAAGGCAGCGCTCTCGG + Intergenic
1181516713 22:23418271-23418293 TGCAGTCAGGGCAAGGCTCTGGG + Intergenic
1182883724 22:33755709-33755731 CGCTGGTAGGGAAGGGCTCTTGG - Intronic
1184307346 22:43614630-43614652 CACTTTCAGAGCAGCCCTCTAGG - Intronic
1184645457 22:45892464-45892486 CCCTGTCTGGGCAGGGCCCTGGG + Intergenic
1184855476 22:47144214-47144236 CGCTGTCAGAGCCGTGCACTTGG + Intronic
962273670 3:133996446-133996468 CACTGTCAGAGCAGAGCACTGGG - Intronic
966820607 3:183921418-183921440 CGCCGTCAGGACACAGCTCTGGG + Intronic
967917564 3:194590066-194590088 AGCTGTCAGGGCATCTTTCTTGG - Intronic
980234701 4:130090515-130090537 CGCTGTGAGGGCCCCTCTCTGGG + Intergenic
984538511 4:181007046-181007068 CCCTGTCAGGGGAGAGGTCTGGG - Intergenic
985671173 5:1207366-1207388 AGCGGTCAGGGCAGCCCGCTTGG + Intronic
986944234 5:12995309-12995331 TGTTGTCAGGGCAGCTCTGTTGG - Intergenic
988469995 5:31528819-31528841 CGCTGTCAGGGCAGCGCTCTGGG + Intronic
992203085 5:74403058-74403080 TGCAGCCAGGGCAGAGCTCTTGG + Intergenic
996417274 5:123223679-123223701 CCCTGGCAGCGCAGGGCTCTGGG + Intergenic
1001210394 5:169805658-169805680 GCCTGTCAGGGTAGAGCTCTAGG - Intronic
1001892539 5:175351337-175351359 CTCTGTCACTGCAGCTCTCTGGG + Intergenic
1003901536 6:10659816-10659838 CGCTGTCGGGGCCCCTCTCTGGG + Intergenic
1005524920 6:26637175-26637197 TTCTGTTAGGGCAGCTCTCTGGG + Exonic
1006387093 6:33737310-33737332 TGCTCTCAGGGCACCGCTGTGGG - Intronic
1006387098 6:33737337-33737359 TGCTCTCAGGGCACCGCTGTGGG - Intronic
1007397520 6:41586133-41586155 GGGTGTCAGGGCAGCCTTCTGGG - Intronic
1007521275 6:42452994-42453016 CGCTGGAAGAGCAGCTCTCTGGG + Intergenic
1007532337 6:42554158-42554180 CGCTGTGAGGGCCCCTCTCTGGG + Intergenic
1012220948 6:96648702-96648724 AGCTGTCAGGGCACGGCTCCTGG + Intergenic
1015811579 6:137166531-137166553 CGCTGTCATTGCAGCTCTTTTGG - Intronic
1017935196 6:158999465-158999487 CGCTGGCAGGGCAGTGCTCGGGG + Exonic
1018580137 6:165301483-165301505 TGCTCTCAGGGCACAGCTCTGGG - Intronic
1018580141 6:165301511-165301533 AGCTCTCAGGGCATAGCTCTCGG - Intronic
1023049156 7:36236221-36236243 CGCTGTGAGGGCCCCTCTCTGGG + Intronic
1025029016 7:55540672-55540694 CTCTGTGAGGGCAGCGCCCGTGG - Intronic
1029155751 7:98516682-98516704 AGCTCTCAGGGCTGCTCTCTGGG + Intergenic
1033305540 7:140222871-140222893 CACTGTCAGGGCAGCTGGCTGGG + Intergenic
1034431131 7:151041699-151041721 AGCTGGCAGGGCAGGGCGCTGGG - Intronic
1034449438 7:151129451-151129473 GGCTGTCTGGGCGGTGCTCTCGG - Intronic
1034522465 7:151631824-151631846 CGGGCTCAGGGCTGCGCTCTGGG + Intronic
1034911583 7:155002708-155002730 CGCAGTCAGGCCAGCGGCCTCGG + Intronic
1039301743 8:36216883-36216905 CTCTGTCTAGGCAGCGGTCTAGG + Intergenic
1041570451 8:59332544-59332566 CTCTGTCAGAGCAGAGGTCTAGG + Intergenic
1047593988 8:126357895-126357917 CGCTATAAGGGCAGGGCTTTTGG - Intergenic
1049192174 8:141294552-141294574 GGCTGTGAGGGGACCGCTCTGGG - Intronic
1049990834 9:990225-990247 GGCTGTCAGGGCGGCTCTCGGGG - Exonic
1057682111 9:97198133-97198155 TTCTGTTAGGGCAGCTCTCTGGG + Intergenic
1057883118 9:98808066-98808088 CGCTGTGAGTGCACAGCTCTGGG + Exonic
1061857219 9:133448932-133448954 ACCTGGCAGGGCAGGGCTCTGGG - Intronic
1062736742 9:138141575-138141597 CTCTGGCAGGCCAGAGCTCTGGG - Intergenic
1190050445 X:47145317-47145339 CCCTGGGAGGGCAGCGCGCTTGG + Exonic
1195727862 X:107936037-107936059 CGCTGTGAGCTCAGCGCGCTGGG + Intergenic
1195884618 X:109625403-109625425 CGCTGGCAGGGCAGCTTGCTGGG + Intronic
1200430318 Y:3072603-3072625 CGCTGTGGGGGCTCCGCTCTGGG + Intergenic
1200873686 Y:8128947-8128969 CGCTGTGAGGGCCCCTCTCTGGG - Intergenic