ID: 988473446

View in Genome Browser
Species Human (GRCh38)
Location 5:31562551-31562573
Sequence TGGGGAAACCTAAACTAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988473446_988473452 4 Left 988473446 5:31562551-31562573 CCGTCTTAGTTTAGGTTTCCCCA No data
Right 988473452 5:31562578-31562600 CAGACATTAAGGCAAGGATCTGG No data
988473446_988473454 27 Left 988473446 5:31562551-31562573 CCGTCTTAGTTTAGGTTTCCCCA No data
Right 988473454 5:31562601-31562623 GTGAATGTAGTTTATTTGAGAGG No data
988473446_988473453 5 Left 988473446 5:31562551-31562573 CCGTCTTAGTTTAGGTTTCCCCA No data
Right 988473453 5:31562579-31562601 AGACATTAAGGCAAGGATCTGGG No data
988473446_988473451 -2 Left 988473446 5:31562551-31562573 CCGTCTTAGTTTAGGTTTCCCCA No data
Right 988473451 5:31562572-31562594 CAAAAGCAGACATTAAGGCAAGG No data
988473446_988473447 -7 Left 988473446 5:31562551-31562573 CCGTCTTAGTTTAGGTTTCCCCA No data
Right 988473447 5:31562567-31562589 TTCCCCAAAAGCAGACATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988473446 Original CRISPR TGGGGAAACCTAAACTAAGA CGG (reversed) Intergenic
No off target data available for this crispr