ID: 988478829

View in Genome Browser
Species Human (GRCh38)
Location 5:31612288-31612310
Sequence TACAGTGAGGTGAATACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988478829_988478834 8 Left 988478829 5:31612288-31612310 CCTGCTGTATTCACCTCACTGTA No data
Right 988478834 5:31612319-31612341 AGGTAGGGATGTATATGATATGG No data
988478829_988478833 -7 Left 988478829 5:31612288-31612310 CCTGCTGTATTCACCTCACTGTA No data
Right 988478833 5:31612304-31612326 CACTGTATTAAGAATAGGTAGGG No data
988478829_988478835 23 Left 988478829 5:31612288-31612310 CCTGCTGTATTCACCTCACTGTA No data
Right 988478835 5:31612334-31612356 TGATATGGAAGAATAAAATAAGG No data
988478829_988478832 -8 Left 988478829 5:31612288-31612310 CCTGCTGTATTCACCTCACTGTA No data
Right 988478832 5:31612303-31612325 TCACTGTATTAAGAATAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988478829 Original CRISPR TACAGTGAGGTGAATACAGC AGG (reversed) Intergenic
No off target data available for this crispr