ID: 988480492

View in Genome Browser
Species Human (GRCh38)
Location 5:31626417-31626439
Sequence CCCAGACCTGCTCTAAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988480488_988480492 -7 Left 988480488 5:31626401-31626423 CCATCTGGGAATGCTTCCCAGAC No data
Right 988480492 5:31626417-31626439 CCCAGACCTGCTCTAAATTGGGG No data
988480487_988480492 0 Left 988480487 5:31626394-31626416 CCAGGAGCCATCTGGGAATGCTT No data
Right 988480492 5:31626417-31626439 CCCAGACCTGCTCTAAATTGGGG No data
988480483_988480492 19 Left 988480483 5:31626375-31626397 CCAGAAAAAGCAATGACATCCAG No data
Right 988480492 5:31626417-31626439 CCCAGACCTGCTCTAAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988480492 Original CRISPR CCCAGACCTGCTCTAAATTG GGG Intergenic
No off target data available for this crispr