ID: 988481887

View in Genome Browser
Species Human (GRCh38)
Location 5:31638594-31638616
Sequence ATCCCCCAGTTAAGCCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988481887_988481891 2 Left 988481887 5:31638594-31638616 CCCCAGGGGCTTAACTGGGGGAT No data
Right 988481891 5:31638619-31638641 AGCAGCTCTGAGGTGCCAAGAGG No data
988481887_988481890 -8 Left 988481887 5:31638594-31638616 CCCCAGGGGCTTAACTGGGGGAT No data
Right 988481890 5:31638609-31638631 TGGGGGATTAAGCAGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988481887 Original CRISPR ATCCCCCAGTTAAGCCCCTG GGG (reversed) Intergenic