ID: 988483650

View in Genome Browser
Species Human (GRCh38)
Location 5:31650140-31650162
Sequence GTGTTAACAATCTGTGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 2, 1: 0, 2: 0, 3: 14, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988483646_988483650 14 Left 988483646 5:31650103-31650125 CCTCTGTTAATAATCTGAGTGAG 0: 1
1: 0
2: 0
3: 16
4: 120
Right 988483650 5:31650140-31650162 GTGTTAACAATCTGTGTCCTGGG 0: 2
1: 0
2: 0
3: 14
4: 168
988483645_988483650 15 Left 988483645 5:31650102-31650124 CCCTCTGTTAATAATCTGAGTGA 0: 1
1: 0
2: 2
3: 15
4: 158
Right 988483650 5:31650140-31650162 GTGTTAACAATCTGTGTCCTGGG 0: 2
1: 0
2: 0
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988483650 Original CRISPR GTGTTAACAATCTGTGTCCT GGG Intronic
903508713 1:23857241-23857263 GTATTAACAATCTGAATTCTTGG + Intronic
904531196 1:31170857-31170879 CTGTCAACAACCTGTGACCTTGG - Intergenic
905444355 1:38015912-38015934 CTCTGAACAATCTGTGACCTTGG - Intronic
907731568 1:57071521-57071543 GTGTGAACAAGCTGTGTACCAGG - Exonic
908192258 1:61715316-61715338 GTGTTTCCAATCTGTGACATGGG + Intronic
910623899 1:89285742-89285764 TTTTTAACAACCTGCGTCCTTGG + Intergenic
911587295 1:99705292-99705314 CTGGTAACCATCTGTGACCTGGG + Intergenic
916427790 1:164698112-164698134 CTCTTAACAATCGGTGCCCTGGG - Intronic
917958062 1:180120543-180120565 TGGTTAACAATGTGTGCCCTTGG + Intergenic
917993363 1:180407437-180407459 GTGTAAGCTATCTGTGTTCTAGG + Intronic
922466502 1:225848617-225848639 GTGTTAATAGTCTGTGTGTTTGG - Intronic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
924587395 1:245372041-245372063 GTGGTATCAATCTGTGGCCTGGG - Intronic
924700122 1:246442854-246442876 CTGGTAAGAATCTGTGCCCTGGG + Intronic
1071183366 10:83012892-83012914 GTCTTAAAAAGCTGTTTCCTAGG - Intergenic
1072591109 10:96829557-96829579 GTCTTATCTATCTATGTCCTCGG + Intergenic
1076135575 10:128043517-128043539 CTGATATCCATCTGTGTCCTGGG + Intronic
1076593175 10:131605368-131605390 GTGGAAACAACCTGTGTCCATGG + Intergenic
1078843199 11:15097752-15097774 GTGTGAAGAATCTGTGCTCTTGG - Intergenic
1079231293 11:18651123-18651145 GTGTTAAGTATCTGTCTTCTAGG + Intergenic
1079831278 11:25272029-25272051 GCTTTAAAAATATGTGTCCTTGG + Intergenic
1080248608 11:30208010-30208032 GTGTCAACAATCTGACTCCAGGG - Intergenic
1081616923 11:44596630-44596652 GTGTTAACTGTCTGTGTACTGGG + Intronic
1087769218 11:102189435-102189457 TTGTTACCAATCTGTGTTTTAGG + Intronic
1089794183 11:120967152-120967174 GCATTCACAACCTGTGTCCTGGG + Intronic
1090453045 11:126823442-126823464 ATGTTAGACATCTGTGTCCTGGG + Intronic
1093361782 12:18237998-18238020 GAGATAACTCTCTGTGTCCTGGG + Intronic
1095730771 12:45504721-45504743 GGTTTAAGACTCTGTGTCCTGGG - Intergenic
1096520580 12:52182450-52182472 TTGCTAACCAGCTGTGTCCTGGG + Intronic
1096593882 12:52681734-52681756 GTTTTATCACTCTGAGTCCTTGG + Intergenic
1100021952 12:90079817-90079839 GAGATACCTATCTGTGTCCTCGG + Intergenic
1100602938 12:96127899-96127921 GTGTTAACAATCCCTGTCTGAGG - Intergenic
1102745966 12:115249359-115249381 TGGTTAACAATCTCTGTTCTAGG - Intergenic
1106455137 13:29920198-29920220 TTGTTAGCAATCTGTCTCCATGG + Intergenic
1106698967 13:32208701-32208723 GTTTTATCATTCTGTGGCCTTGG + Intronic
1108300884 13:49074721-49074743 ATGTTAACAATGTGTATCTTAGG + Intronic
1111366216 13:87249291-87249313 ATGTTCACAATCTGAGTGCTGGG - Intergenic
1113166443 13:107448793-107448815 ATGATAATATTCTGTGTCCTTGG - Intronic
1113356732 13:109588274-109588296 GCCTTACCAATGTGTGTCCTGGG + Intergenic
1113785156 13:112998591-112998613 GTGTTCAAAATGTGTGTCCCTGG + Intronic
1117556008 14:56884658-56884680 GTTTTGCCAATCTGTGTTCTTGG - Intergenic
1118312219 14:64702762-64702784 CTCTTAACAAACTGTGTCCCTGG - Intergenic
1118431293 14:65720975-65720997 GTGCAAAGAATCTGTGTGCTTGG - Intronic
1118680547 14:68237078-68237100 GTCTCAAAAATCTCTGTCCTGGG + Intronic
1121561514 14:94879699-94879721 GTGTTCACTAGCTCTGTCCTTGG - Intergenic
1127680947 15:61297719-61297741 GGGTTAAGAATCTCTCTCCTAGG - Intergenic
1128506133 15:68274159-68274181 GTGGTACCAATCGGTATCCTGGG - Intergenic
1128890528 15:71327851-71327873 GTGTTAACAATGTAGGGCCTAGG + Intronic
1130155205 15:81344454-81344476 CTCTTTACTATCTGTGTCCTTGG + Intronic
1130871715 15:87977205-87977227 GTGTTCACAATCTGTTCCATTGG - Intronic
1131155272 15:90071280-90071302 GTATTAACACTCTGTGGACTTGG - Intronic
1133887174 16:9841120-9841142 GTGCTAACATTCTGTGGTCTTGG - Intronic
1136923289 16:34349576-34349598 ATTTTTACAATCTGTGCCCTGGG - Intergenic
1136981284 16:35062230-35062252 ATTTTTACAATCTGTGCCCTGGG + Intergenic
1137315859 16:47322279-47322301 TAGTTAACTTTCTGTGTCCTTGG - Intronic
1140718961 16:77753145-77753167 TGCTTAACAATCTGTTTCCTTGG + Intergenic
1143303426 17:5927812-5927834 GTCTTCAAATTCTGTGTCCTAGG - Intronic
1144292076 17:13836401-13836423 ATGTTTTGAATCTGTGTCCTTGG - Intergenic
1144307193 17:13979325-13979347 ATGTAAATATTCTGTGTCCTGGG + Intergenic
1146471041 17:33125124-33125146 TTGGTAACAGTCTGTGGCCTGGG + Intronic
1148669235 17:49397981-49398003 GTGTTATAAATCTGTGTGCCAGG + Intronic
1149690037 17:58567846-58567868 GTGTTACCAGACTTTGTCCTGGG - Intronic
1150686559 17:67325758-67325780 GTGATGACAATTTGGGTCCTAGG + Intergenic
1152468159 17:80477041-80477063 GTGTTGACGACCTGGGTCCTTGG - Intronic
1156445637 18:37234965-37234987 CTGTTTCCAATCTGTCTCCTAGG - Intergenic
1161567371 19:5011233-5011255 ATGTTTACAAACTGTGGCCTGGG + Intronic
1166630510 19:44402360-44402382 GTGAGAACAATCTGTCTCCTAGG + Intergenic
925467750 2:4124502-4124524 GTCTTAACAACCTGTTTCCAAGG + Intergenic
925927402 2:8679970-8679992 ATGTTAACATACGGTGTCCTTGG + Intronic
927427075 2:22993437-22993459 GTCTTCAGAATCTGTGTTCTTGG + Intergenic
928702386 2:33912193-33912215 GAGTTAAGAATCTCTGCCCTAGG + Intergenic
930217751 2:48714364-48714386 GTGTTAAACATCTCTGGCCTTGG - Intronic
930239349 2:48920255-48920277 GTGTTTTCAATCTGTGTCTATGG - Intergenic
931260893 2:60618065-60618087 GTGTTTACACTTTTTGTCCTAGG + Intergenic
933574416 2:84051072-84051094 GGGTTAACATTCTGAGTCCTGGG - Intergenic
936434002 2:112487594-112487616 GTGATAAATATCTGTGACCTTGG + Intronic
937118046 2:119423111-119423133 GTGTGCACAACCTGTGTCCCAGG - Intergenic
938543156 2:132303348-132303370 GTGAGAACAATCTCTCTCCTAGG - Intergenic
940820465 2:158349809-158349831 GTGAGAACAAAATGTGTCCTAGG - Intronic
941215786 2:162707018-162707040 GTGTTAATAAGTTGTGTTCTTGG - Intronic
945158046 2:206859897-206859919 CTGTTCACACTCTGTGTCCGTGG + Intergenic
1169841131 20:9939074-9939096 GTGTTAATAATCTGTTCCCTTGG - Intergenic
1171872040 20:30536182-30536204 GTGAGAACAATCTCTCTCCTAGG - Intergenic
1172493523 20:35360761-35360783 GCGCTCACTATCTGTGTCCTGGG - Intronic
1173857534 20:46260294-46260316 GACAGAACAATCTGTGTCCTTGG + Intronic
1176817854 21:13623396-13623418 GTGGTACCAGTCTGTGACCTGGG + Intronic
1178784788 21:35643459-35643481 TGCTTAAGAATCTGTGTCCTTGG + Intronic
1180249390 21:46571012-46571034 CTGTTAACAGTCTGTGGCCCAGG - Intergenic
1180764422 22:18235234-18235256 GTGACATCAGTCTGTGTCCTGGG + Intergenic
1180771218 22:18389307-18389329 GTGACATCAGTCTGTGTCCTGGG - Intergenic
1180802604 22:18638922-18638944 GTGAGATCAGTCTGTGTCCTGGG - Intergenic
1181219119 22:21356339-21356361 GTGAGATCAGTCTGTGTCCTGGG + Intergenic
1203233056 22_KI270731v1_random:130298-130320 GTGACATCAGTCTGTGTCCTGGG - Intergenic
949373484 3:3361387-3361409 GTGTTAACAAGCTCTGTCCAAGG + Intergenic
949893154 3:8748189-8748211 GTGTTAACATGCTGATTCCTGGG - Intronic
951601204 3:24377738-24377760 TTGTTAAAAAGCTGTGTCTTGGG + Intronic
951614316 3:24524428-24524450 GTGTTAACAATCTCTGACTTAGG + Intergenic
951915944 3:27800926-27800948 ATGTTAGCAATGAGTGTCCTTGG + Intergenic
955746620 3:62147068-62147090 GTCTTAACAACCTATGACCTTGG + Intronic
955760769 3:62279594-62279616 GTCTTTAATATCTGTGTCCTTGG + Intronic
956697598 3:71931799-71931821 CTATTAACAATCTGTCTACTGGG - Intergenic
956740789 3:72274147-72274169 GGGTTAGCAAACTGTGCCCTGGG - Intergenic
960202128 3:114849712-114849734 GTGTATATAATCTGTGACCTAGG - Intronic
964803989 3:160587113-160587135 GTGTGGAGAATCTGTGTGCTTGG + Intergenic
965582508 3:170284196-170284218 GGGTTCTCAATCTGGGTCCTTGG - Intronic
968100672 3:195962553-195962575 CTGGTAACGATCTGTGGCCTGGG + Intergenic
968534932 4:1118870-1118892 ATGTTAATGGTCTGTGTCCTTGG + Intergenic
970000400 4:11359513-11359535 ATGTTAACAATGTATATCCTTGG + Intergenic
970507716 4:16748986-16749008 GTGTTACCTTTCTGTGCCCTGGG - Intronic
971753989 4:30684291-30684313 GTATTAAAAATCTATGTCATTGG + Intergenic
972586455 4:40441518-40441540 GTAGTTACAATCTGTGACCTAGG + Intronic
976104226 4:81599880-81599902 ATGTTAAAAATATGTGTCTTGGG - Intronic
977644382 4:99395619-99395641 GTGCAGACAATCTGTGTGCTTGG + Intergenic
981827042 4:148955265-148955287 TTGTTAACATTCTGAGTCTTGGG + Intergenic
983839124 4:172433880-172433902 GTGTTACAAACCTGTGTACTGGG - Intronic
985502400 5:257232-257254 CTGGTAACAATCTGTGGCCTGGG - Intergenic
985734619 5:1571365-1571387 CTGGTAACAATCTGTGGCCTGGG + Intergenic
988483650 5:31650140-31650162 GTGTTAACAATCTGTGTCCTGGG + Intronic
988483683 5:31650489-31650511 GTGTTAACAATCTGTGTCCTGGG - Intronic
989476490 5:41880307-41880329 GTGTTAAGAATCTGTGTGACAGG + Intergenic
990349114 5:54898111-54898133 GTGTAAAGAGCCTGTGTCCTTGG - Intergenic
992075787 5:73191567-73191589 GAGTTCACAGTCTGGGTCCTCGG + Intergenic
992164531 5:74036210-74036232 ATGTTCAGAATCTGTGTACTTGG + Intergenic
994594559 5:101815689-101815711 GTGGTAACACTTAGTGTCCTGGG - Intergenic
995046718 5:107658236-107658258 GTGTTAAAAATCTGTTTCTGCGG + Intronic
996172806 5:120315468-120315490 GTGTTATAAATCTCTCTCCTTGG - Intergenic
997257012 5:132436810-132436832 GTGTTATCAAACTGTGCCTTTGG + Intronic
998956035 5:147439353-147439375 ATGTGAATAATCTGAGTCCTAGG + Intronic
999588413 5:153117057-153117079 GGGTTAAAGATCTGTGGCCTTGG - Intergenic
1000108271 5:158081697-158081719 TTGTGAAGAATCTATGTCCTTGG + Intergenic
1000306434 5:159999081-159999103 TTGTTCATAATCTGTGTCTTTGG + Intergenic
1001587822 5:172845219-172845241 GTGTTTACAGTCTGTTGCCTTGG + Intronic
1001900646 5:175425376-175425398 GTGTTTACTATCTGGGTCATGGG + Intergenic
1008128295 6:47692626-47692648 GGGTTAACAATCACTGGCCTAGG + Intronic
1008481943 6:51994907-51994929 GTGTTACCTACCTGTGTGCTTGG - Intronic
1009048192 6:58252252-58252274 GTGTAAACATTCTGTGACATTGG - Intergenic
1009388331 6:63113697-63113719 TTGTTCATAATCAGTGTCCTGGG + Intergenic
1009611959 6:65956397-65956419 ATGCTCAAAATCTGTGTCCTGGG - Intergenic
1010500653 6:76595145-76595167 GTTTTTACAATGTGTTTCCTAGG - Intergenic
1010528057 6:76927575-76927597 GTGATTACTATCTGAGTCCTTGG - Intergenic
1013273918 6:108565975-108565997 GTGTGAAGAATCTGTCTGCTTGG + Intronic
1013360567 6:109390431-109390453 GTGTTAAGAATGTGTGTTCTAGG - Intronic
1015456252 6:133429960-133429982 GTGTTCACAATCTGGGTGATGGG - Intronic
1016760591 6:147731913-147731935 GTGTAGTCAATCTGTTTCCTTGG - Intronic
1021849766 7:24796062-24796084 GTGTTAATTATCTGTGTTGTTGG + Intergenic
1025995513 7:66525042-66525064 GTATTAATACTCTGTGTCCCAGG + Intergenic
1026987169 7:74561909-74561931 GTGTTAATACTCTGTGTCCCAGG + Intronic
1027059086 7:75071155-75071177 GTCTTAATAATATGTGTTCTTGG - Intronic
1027834632 7:83224515-83224537 ATGTCAACAATCTGATTCCTAGG + Intergenic
1028205247 7:88009188-88009210 GTGATAACAAACTGTGTCATGGG - Intronic
1028555187 7:92115969-92115991 CTGTTAACAATCTGATTCTTTGG + Intronic
1029299740 7:99570859-99570881 GTATTAAAATTCTGTCTCCTTGG + Intronic
1029705895 7:102275397-102275419 GTGTTCCCCAACTGTGTCCTTGG - Intronic
1031495652 7:122444871-122444893 GGGTGAAAAATCTGTGTCTTTGG - Intronic
1032981343 7:137286983-137287005 GTATTAACTATCTGTGTGGTTGG - Intronic
1036146972 8:6263042-6263064 ATGATAACATTCTGTGTTCTTGG + Intergenic
1036500072 8:9305626-9305648 TTGTTAGCCATATGTGTCCTTGG - Intergenic
1036556074 8:9861740-9861762 GTGAGAACATTCTGAGTCCTTGG - Intergenic
1038588074 8:28809360-28809382 ATGTTAGCAAACTGTGGCCTGGG - Intronic
1038717750 8:30007103-30007125 GTTTTGACAACCTGTGTCCAAGG - Intergenic
1040638299 8:49301633-49301655 CTGTTAACAATCTTTTTCCAGGG + Intergenic
1043252323 8:78090059-78090081 GTGTTCACAATCTGAGTGATGGG + Intergenic
1046692944 8:117306426-117306448 CTGTTAACTATGTGTGACCTGGG - Intergenic
1047344897 8:124018129-124018151 TTGTTACCCCTCTGTGTCCTGGG + Intronic
1048475032 8:134735156-134735178 GTTTTAAAAATCTGGGTCCATGG + Intergenic
1048525536 8:135198995-135199017 GTGTAAACCATGTCTGTCCTGGG - Intergenic
1051768067 9:20546188-20546210 CTTTTTACAATCTGTGTCTTTGG - Intronic
1052456458 9:28705410-28705432 GTGTCCACAATCTGTCTCCTTGG + Intergenic
1053729621 9:41039928-41039950 GTGTCAAGAATCTGGGCCCTTGG - Intergenic
1055950059 9:81722136-81722158 TTGCTAACAATCTGGGTCCAAGG - Intergenic
1056377317 9:86027279-86027301 GTGTTAACAGTCAGTGCTCTAGG + Exonic
1059568066 9:115403511-115403533 GTGTTAATTATCAGTGTCATAGG - Intergenic
1059887462 9:118762089-118762111 TTTTTAAAAAACTGTGTCCTGGG + Intergenic
1062219512 9:135407224-135407246 ATTTGCACAATCTGTGTCCTGGG + Intergenic
1203529505 Un_GL000213v1:126105-126127 GTGGTACCAGTCTGTGACCTGGG - Intergenic
1186253639 X:7696749-7696771 TTTTTAAAGATCTGTGTCCTGGG - Intergenic
1188037659 X:25336971-25336993 GTGTTAATTTTCTGTGTCGTTGG + Intergenic
1189908225 X:45783498-45783520 GTGTTAGCTATTTTTGTCCTTGG - Intergenic
1191580356 X:62754248-62754270 GTGTTATTAATCTGTGTTTTTGG - Intergenic
1193923911 X:87462960-87462982 GTGAAAAAAATCTGTGTACTAGG + Intergenic
1197293006 X:124683242-124683264 GTGTCAGCTCTCTGTGTCCTAGG - Intronic
1198266896 X:135017936-135017958 GAGTTAATAATCAGTGTCCATGG + Intergenic
1200523032 Y:4235271-4235293 GTGTTATTAATATGTGTTCTAGG + Intergenic
1201343381 Y:12957229-12957251 GAGTTAACGATCTGTTTCCTGGG - Intergenic