ID: 988484107

View in Genome Browser
Species Human (GRCh38)
Location 5:31654224-31654246
Sequence GTGTGTGTCAAATGCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988484107_988484115 28 Left 988484107 5:31654224-31654246 CCCTCAAAGCATTTGACACACAC 0: 1
1: 0
2: 2
3: 16
4: 212
Right 988484115 5:31654275-31654297 CACTCCTTACCTTGGCTCTCTGG 0: 1
1: 0
2: 3
3: 22
4: 201
988484107_988484114 20 Left 988484107 5:31654224-31654246 CCCTCAAAGCATTTGACACACAC 0: 1
1: 0
2: 2
3: 16
4: 212
Right 988484114 5:31654267-31654289 CATTGAAACACTCCTTACCTTGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988484107 Original CRISPR GTGTGTGTCAAATGCTTTGA GGG (reversed) Intronic
900888185 1:5430169-5430191 GAGTGTGGTAAAAGCTTTGAAGG - Intergenic
900888189 1:5430193-5430215 GTGGGTGTCAGATGCTTTGGAGG - Intergenic
901163301 1:7197218-7197240 GTGTGTGTCAAATGTGAGGATGG + Intronic
904602020 1:31678646-31678668 TTATGTGACAAATGCTTAGAAGG - Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
907232823 1:53016014-53016036 GTGTGTCTCATATCCTTTGTTGG - Intronic
909966160 1:81913281-81913303 TTGTGTGCCAGAGGCTTTGAAGG + Intronic
910235390 1:85030666-85030688 TTGATTGTGAAATGCTTTGATGG - Intronic
910283961 1:85532410-85532432 GTGAGTATCAAATTCTATGAAGG + Intronic
911102115 1:94103383-94103405 GGGGGTGTCAGATGCTTTGTGGG + Intronic
912574028 1:110648192-110648214 TTTTGTGTCAAGTTCTTTGATGG + Intergenic
914206057 1:145530575-145530597 GTGAGTATCAAATTCTATGAAGG - Intergenic
917092904 1:171371902-171371924 GATTGTGAAAAATGCTTTGAAGG + Intergenic
918948461 1:191102179-191102201 GTATTTGTCAAATTCTGTGAAGG + Intergenic
919376698 1:196803607-196803629 ATGTGTGACAAAGGTTTTGATGG - Intergenic
919386406 1:196928499-196928521 ATGTGTGACAAAGGTTTTGATGG - Intronic
919389172 1:196960466-196960488 ATGTGTGTCAAAGGTTCTGATGG - Intergenic
919537088 1:198800979-198801001 GTGTGTGTCAAATCATCTGTTGG + Intergenic
922850170 1:228726325-228726347 GTGTAAGTCTAATGGTTTGATGG + Intergenic
923143073 1:231177843-231177865 CTGGGTGTCAGATGCTCTGATGG - Intronic
923816573 1:237385909-237385931 CTGTGTGATAATTGCTTTGAAGG + Intronic
1063617037 10:7609220-7609242 GTGCGTATCAAGTGCTGTGAGGG - Intronic
1065137234 10:22683822-22683844 GTGTGTGTGAACTGCTTGGTAGG - Intronic
1065160434 10:22914503-22914525 GTGTGTGTAAAATACTTGCAGGG + Intergenic
1066471708 10:35704192-35704214 GTGTGTGTCTATTGCTCTGGCGG - Intergenic
1067221496 10:44347388-44347410 GTGTGTGTTAGATTCTTAGATGG + Intergenic
1067234829 10:44438854-44438876 GTGTGTGTCACATGCATTGAGGG - Intergenic
1068014396 10:51497323-51497345 GTGTTTATCAAATGATTGGATGG - Intronic
1068838871 10:61587951-61587973 TTATGTGTTAAATGCATTGAAGG - Intergenic
1069801092 10:71082060-71082082 GGGTGTCTCAAATTGTTTGATGG + Intergenic
1072299124 10:94041821-94041843 ATTGGTGTCAAATGGTTTGAAGG - Intronic
1072838881 10:98747870-98747892 CTGTGTGTTAGATGCTATGAAGG - Intronic
1073756760 10:106589077-106589099 ATGTATCTCAAATGCTTTGAGGG + Intronic
1073833996 10:107419708-107419730 GTACGTGTCATATCCTTTGATGG + Intergenic
1075569611 10:123530308-123530330 CTCTGTGTCAGATGCTTTGCAGG - Intergenic
1075671581 10:124267003-124267025 GTGTGAGACCAATGCTTTCAGGG - Intergenic
1076362723 10:129900783-129900805 ATGGGTGTCAAAGGCTGTGACGG - Intronic
1078370496 11:10740741-10740763 GTGTGGCTCACATGCTCTGAAGG + Intergenic
1083670580 11:64297780-64297802 GTGTGTGTGCAAGGCTGTGATGG - Intronic
1085821762 11:79801403-79801425 GTGTGTGGTACATGCTATGAAGG - Intergenic
1086377014 11:86211475-86211497 GTATGTGTCATCTGCATTGATGG - Intergenic
1087224918 11:95588045-95588067 GAGTGTGGCAATTGCTATGATGG + Intergenic
1087286785 11:96272661-96272683 GTGTGTGTTAAATCATTTTAAGG - Intronic
1088040729 11:105378167-105378189 ATGTGAGTGAAATGCTTTGGGGG + Intergenic
1090693052 11:129205826-129205848 GAGTGTGGTAATTGCTTTGAAGG - Intronic
1099304195 12:80935244-80935266 GAGTGTGATAAATGCTTTAATGG + Intronic
1101714544 12:107299107-107299129 GTGTGTGTCAAATGTCATAAGGG + Intergenic
1101949622 12:109164531-109164553 CTGTGTGTGAAATGCTAGGAAGG - Intronic
1107251222 13:38364896-38364918 CTGTGTGTCAAATATTTTGACGG + Intergenic
1108010556 13:46004154-46004176 GTGTGTGTCACATACATTCATGG + Intronic
1108132628 13:47319330-47319352 GTTTGACTCAAATGCTTTGGTGG + Intergenic
1109638726 13:65158501-65158523 TTGTGTTTCAAATGCTTTTTAGG - Intergenic
1111001235 13:82185924-82185946 GTGTGTGTCAAGAACTGTGAAGG - Intergenic
1113274350 13:108711856-108711878 GTGTGTGGAAAATGCATTCATGG + Intronic
1113795552 13:113055762-113055784 GTGTGGGTAAGATGCTGTGACGG - Intronic
1116020887 14:39459172-39459194 TTGTGTGTCAAGTGCTTTATTGG + Intergenic
1117977772 14:61315466-61315488 ATGTTTGTCAAGTGCTTTGTTGG + Intronic
1118855869 14:69621797-69621819 GTGTGGGTCATCTCCTTTGAAGG + Intronic
1119806166 14:77484012-77484034 GTGAGTGGGAAATGCTTTGTAGG - Intronic
1121401789 14:93685893-93685915 GTGTGTTTGAAAAGTTTTGAAGG - Intronic
1121642673 14:95496199-95496221 GTGTCTGGCATAGGCTTTGAAGG - Intergenic
1121680426 14:95788758-95788780 GCATGTGTCAGATGCTATGATGG + Intergenic
1123429986 15:20206363-20206385 GTCTTTTTCAAAAGCTTTGAAGG - Intergenic
1126314579 15:47356595-47356617 GTGTGTGTCATAGGATATGAGGG + Intronic
1130578464 15:85114447-85114469 ATGTGTGTGGGATGCTTTGAAGG - Intronic
1131061967 15:89409985-89410007 GTTTGTGTTAAATGCCTTGATGG + Intergenic
1133648297 16:7785155-7785177 GTATTTGTTAAATGCTTTAATGG + Intergenic
1137634242 16:49971848-49971870 GTGTGGGTCACCTGCTTTGTGGG - Intergenic
1138163318 16:54776741-54776763 GTAACTGTCAAATGCTATGAGGG - Intergenic
1139301996 16:65953259-65953281 GTGGGTTTCAAAGGCTTTGGAGG - Intergenic
1140383241 16:74509995-74510017 GTATGTGTCAAGTGTTTTAAGGG - Intronic
1140792280 16:78403564-78403586 AAGTGGGTAAAATGCTTTGAGGG + Intronic
1203116222 16_KI270728v1_random:1493325-1493347 GTCTTTTTCAAAAGCTTTGAAGG + Intergenic
1142725710 17:1812205-1812227 ATGTGTGTGAAATGTTTTGCGGG - Intronic
1143570075 17:7752146-7752168 GTGTGTGTAAAATGACTTAAGGG - Intronic
1148855446 17:50576620-50576642 GTGCCTGTCACATGCTTTGCGGG + Intronic
1150248139 17:63691243-63691265 GTGTGTCTCACATGCATTCAAGG - Intronic
1151577700 17:74961008-74961030 GTGTGTGACAAATACCTCGAAGG - Intronic
1153645547 18:7193020-7193042 TTCTGAGTCAAATGCTGTGATGG + Intergenic
1154355429 18:13620580-13620602 GTGTGTGTCAATGGCATTTAAGG + Intronic
1155174501 18:23290600-23290622 GAGTGAGTTAAATGCTTTTAAGG - Intronic
1155979573 18:32166336-32166358 ATGTGTCTCACATGCTTAGAAGG + Intronic
1158306188 18:56108560-56108582 GTCAGTGCCAAATGATTTGATGG + Intergenic
1160479684 18:79227376-79227398 GTGTGTGTGAATTGCATGGATGG + Intronic
1160816731 19:1039474-1039496 GTGTGGGTCCACAGCTTTGAAGG - Intergenic
1161727147 19:5936138-5936160 GTGTGCATCAAATGCTGAGAAGG + Intronic
1162901408 19:13797047-13797069 GTGTGTCTCACATGCAATGAAGG - Intronic
1164727237 19:30474339-30474361 GTGTGTGTGAAATGATTAGGGGG + Intronic
1165352633 19:35284471-35284493 CTGTGTGGCAAATGGATTGAGGG + Intronic
1166901887 19:46070846-46070868 GTGTGTGCAAAGTGTTTTGAAGG + Intronic
926449441 2:12984157-12984179 GTGGGTTTCCAGTGCTTTGAAGG - Intergenic
928044364 2:27913056-27913078 GTGTTTTTCAAACTCTTTGATGG + Intronic
930046128 2:47175181-47175203 TTGTCTGTCAAATACTGTGATGG - Intronic
933152709 2:78934276-78934298 CTATGTGTCAAATGCTCTGAAGG + Intergenic
933753826 2:85621558-85621580 GTGTGTGGCAAGTACTTTCAAGG + Exonic
935569099 2:104640542-104640564 GTATATGTCAAATACTATGATGG + Intergenic
935610712 2:105022314-105022336 GTCATTTTCAAATGCTTTGAGGG - Intergenic
937524868 2:122755813-122755835 GTGTGTTTAAAATGCTTCGGTGG - Intergenic
938937740 2:136142188-136142210 CTGTTTGTAAAATGCTGTGAAGG + Intergenic
939063161 2:137449102-137449124 GTATCTGTCAATTACTTTGAGGG - Intronic
939624054 2:144454866-144454888 GTGTGTGTGTGATGCTCTGATGG - Intronic
940665679 2:156606220-156606242 CTGAGTGTCAAATGCTATTATGG - Intronic
941202992 2:162537953-162537975 GTGTGAGGAAACTGCTTTGAGGG - Intronic
941572125 2:167184058-167184080 GAATTTGGCAAATGCTTTGAGGG + Intronic
942112192 2:172693504-172693526 GTATATGTAAAATGCTTAGAAGG + Intergenic
943150944 2:184112023-184112045 GTCTATGTCAAGAGCTTTGAAGG - Intergenic
943803436 2:192091199-192091221 GTATCTGTTTAATGCTTTGATGG + Intronic
946126042 2:217563564-217563586 GTATGTGTCAGATGCTGTGCAGG + Intronic
1169037757 20:2467651-2467673 GTGCTTGTCAAAAGCCTTGAAGG + Exonic
1169189253 20:3646962-3646984 AGGTGAGTCAGATGCTTTGAGGG - Exonic
1170616128 20:17953207-17953229 GTGTGTGCTAAATGCTTTCAGGG + Intronic
1170663126 20:18361940-18361962 GTGTGTGTCTATTCCTTTGGAGG - Intergenic
1171369170 20:24649685-24649707 CTGAGTTTCTAATGCTTTGAGGG - Intronic
1173319237 20:41972632-41972654 GTGTGTGTCTAACACTTTAAAGG - Intergenic
1174090212 20:48040658-48040680 GTTTTTGTAAAATGGTTTGAAGG + Intergenic
1177304361 21:19293764-19293786 GGGTGTGATAAATGCTGTGAAGG - Intergenic
1177812051 21:25935103-25935125 CTGTGTGTCAAATGCCTGGCGGG + Intronic
1178598794 21:33978169-33978191 GTGGGTGTTAAACGCTTTAACGG + Intergenic
1179008499 21:37534802-37534824 GTGTGAGTGGCATGCTTTGATGG + Intergenic
1184923564 22:47622473-47622495 GTGAGAGACAAATGCTCTGATGG - Intergenic
1185261264 22:49865344-49865366 GTGTGTGTTAAATGCTTACACGG + Intronic
949754087 3:7389433-7389455 TTATTTGTCTAATGCTTTGATGG + Intronic
950825879 3:15820596-15820618 GTGTGTGTCAGATGTCTTGAAGG - Intronic
952548307 3:34447142-34447164 GTGTTTGTAATATTCTTTGATGG + Intergenic
953559410 3:43973483-43973505 GTATTTGTCAAATAATTTGAAGG + Intergenic
954030865 3:47818958-47818980 CTGTCTGTAAAGTGCTTTGAAGG + Intronic
955610993 3:60757401-60757423 GTTTGTGATAAATGCTGTGAAGG + Intronic
955919041 3:63935451-63935473 GTGTGTGTGAATAGCTTTGGGGG - Intronic
956744879 3:72303545-72303567 GTGTGTGTCTTATACTTTTATGG - Intergenic
956878132 3:73483840-73483862 GTGTGTGAAAAAGGCTGTGAAGG + Intronic
960735344 3:120773195-120773217 GAATTTGTCAAATGCTTTGGTGG - Intronic
961602361 3:128071763-128071785 GTGTGTGTCAAAGGCTTGGTTGG + Intronic
962694450 3:137933790-137933812 ATTTGTGTCAAATGCATTAATGG + Intergenic
963779436 3:149472424-149472446 GTGTTGGTCAAATGCCATGATGG + Intergenic
965635942 3:170780674-170780696 CTGTGTGTCAAATGCTTCACTGG - Intronic
966109930 3:176388095-176388117 TTGTGTCTCAAATGCTTAGTTGG - Intergenic
967680392 3:192355633-192355655 GTGTGTGTCAAGTGGTTTTAAGG + Intronic
967877729 3:194278261-194278283 CTGTGTGTAAAATGCTTTCCTGG + Intergenic
969385081 4:6839398-6839420 GTGTGTGTAAAATGTTCTCATGG + Intronic
971033707 4:22669484-22669506 GTGTGTTTTGAATGATTTGATGG + Intergenic
971672073 4:29574611-29574633 GTGTGTGTTACATTCTTTCATGG + Intergenic
971752415 4:30667522-30667544 GTGTTTATCCCATGCTTTGAAGG - Intergenic
972790393 4:42366253-42366275 ATGTATGTCAAACGCTTTCATGG - Intergenic
974257659 4:59481900-59481922 ATTTTTGTCAAATGCTTTGTTGG - Intergenic
975060424 4:69990512-69990534 CTGTGTGTCAAATGCTATTTTGG + Intergenic
975354703 4:73387775-73387797 TTGTGTGCTAAATGCTTTGGAGG - Intergenic
979959171 4:126995529-126995551 GTGTGTGTGCAAGGTTTTGATGG - Intergenic
981379591 4:144057533-144057555 GTATGTGTAAAGTTCTTTGAAGG - Intergenic
981484163 4:145267665-145267687 GTTTGTGGTAAGTGCTTTGAAGG + Intergenic
982650493 4:158082457-158082479 GTCTGTGCCAGATTCTTTGAAGG - Intergenic
984361197 4:178734980-178735002 GTGTGTGTCAAGAACTCTGAAGG + Intergenic
984387787 4:179085822-179085844 ATGAGTGTCAAATGATTTAATGG - Intergenic
985982586 5:3483521-3483543 CTGTGTATCAAATGCATTGCAGG + Intergenic
986031030 5:3892694-3892716 CTGTGTGTCAAAAGCTTGGCAGG + Intergenic
986312197 5:6559525-6559547 GTGTATGACAAAAGCTTTAAAGG - Intergenic
988445053 5:31276483-31276505 GTGTGTTTCAAAGGACTTGAGGG + Intronic
988484107 5:31654224-31654246 GTGTGTGTCAAATGCTTTGAGGG - Intronic
988964139 5:36399427-36399449 GTGTGTAGCATATGCTCTGAGGG + Intergenic
994164213 5:96592058-96592080 GTGTTTGACCAGTGCTTTGAAGG + Intronic
994806615 5:104456351-104456373 GTGTGTGGGAAATGAGTTGATGG - Intergenic
995430609 5:112071227-112071249 GTGAGTGTCAAAGGTCTTGAGGG + Intergenic
995644654 5:114298055-114298077 GTGTATGTCAATTGCTTAAAAGG + Intergenic
999458787 5:151740139-151740161 TTGTGTGATAAATGCTTTGAGGG + Intergenic
1000230139 5:159308219-159308241 GAGTGTGCTAAATGCTTTGCAGG - Intergenic
1003095499 6:3139959-3139981 GTGAGGTTCATATGCTTTGAGGG + Intronic
1003354004 6:5348084-5348106 GTTTGTGTCATATTCTTTGCCGG + Intronic
1003859998 6:10314239-10314261 GTGCGTGTCCAATGCCTTGGTGG - Intergenic
1005110106 6:22271897-22271919 ATATGTGACATATGCTTTGACGG - Intergenic
1007546412 6:42698119-42698141 CTGTGTGTCAAATGCTTTTAGGG + Exonic
1008178018 6:48292047-48292069 GTGTGTTTAAAATAATTTGATGG + Intergenic
1009451204 6:63803051-63803073 GTGTGTGTTAAAGATTTTGAAGG + Intronic
1009822111 6:68815723-68815745 GTGTATGTAAAATGTATTGAAGG - Intronic
1010920617 6:81675563-81675585 CTGTGTTTCAAATGAATTGAGGG - Intronic
1011779839 6:90775511-90775533 GAGTCTATCAAATGCTTTCATGG - Intergenic
1013223866 6:108105126-108105148 TTGTGTGTAAAAAGATTTGATGG + Intronic
1013877257 6:114847361-114847383 GTGTTTGTCAAAACCTTTTATGG + Intergenic
1014744101 6:125179540-125179562 CTGCTTGTGAAATGCTTTGAGGG - Intronic
1015462722 6:133511377-133511399 GTATGAGTAAAATACTTTGAGGG + Intronic
1016883370 6:148933697-148933719 GTGTGGCTCAGATGGTTTGATGG + Intronic
1021774306 7:24037158-24037180 CTGTGATTCATATGCTTTGAGGG + Intergenic
1022118193 7:27281127-27281149 ATGTTTCTCAAATGCTTTGCAGG + Intergenic
1022446257 7:30473085-30473107 GTGTGTGTGAAGTGCTCTGCTGG - Intronic
1026053089 7:66963198-66963220 GTGTGTGTCCTATGCAGTGAGGG - Intergenic
1028444965 7:90911520-90911542 GCGTGTGTCAACTTCTTTTAAGG - Intronic
1028458337 7:91062643-91062665 CTGTGTATCAAATGCTTTCATGG + Intronic
1029283166 7:99449700-99449722 GCTTGTGACAAGTGCTTTGAAGG + Intronic
1031680442 7:124666860-124666882 GTGTATGTTAAATGTTTAGATGG - Intergenic
1031862933 7:127003016-127003038 GTGTTTCTCAAATTGTTTGAAGG - Intronic
1032703536 7:134403089-134403111 AACTGTGTTAAATGCTTTGATGG + Intergenic
1034062627 7:148107085-148107107 GTGTGTTTCACATGTTTGGAGGG - Intronic
1035775860 8:2187491-2187513 GTGCTTGTCAAATGCTTGCAGGG + Intergenic
1038249306 8:25888187-25888209 TGGTGTGTCCAATCCTTTGAAGG - Intronic
1038704631 8:29881991-29882013 GTGTTTGTCAAGGGGTTTGAAGG + Intergenic
1038906217 8:31906283-31906305 ATTTGTGTCACATGCTCTGAGGG - Intronic
1039840237 8:41287799-41287821 ATGTGTCACAAATGCTTTGAGGG + Intronic
1040069357 8:43177712-43177734 CTGTGTTTCAAGGGCTTTGAGGG + Intronic
1040750787 8:50704322-50704344 TTGTATGTTAAATGCTTTGGTGG + Intronic
1042344516 8:67713694-67713716 CACTGTGTCAAATGCTATGATGG - Intronic
1042918900 8:73902233-73902255 GTCAGTGTCAAAACCTTTGAAGG + Intergenic
1043151984 8:76729259-76729281 GTGTGTGCCTTCTGCTTTGAAGG + Intronic
1044367036 8:91359902-91359924 GTGTGTGTAAACTAATTTGAAGG + Intronic
1044388578 8:91620903-91620925 GTGTTCTTCAAATGCTTTTATGG - Intergenic
1044513974 8:93117067-93117089 GTCAGGGTCAAATGCTTTGGTGG - Intergenic
1045116393 8:98987181-98987203 GTGTGTGTGTGATGCTTTGTTGG + Intergenic
1046264118 8:111808845-111808867 GTATATGTGAAAAGCTTTGAGGG - Intergenic
1047304648 8:123642929-123642951 GTGTGGGGCAAATGTTTTCAAGG + Intergenic
1048847025 8:138611619-138611641 GTGTGTGTCAAATGCAGATATGG - Intronic
1049404691 8:142447193-142447215 GTGTGTCTGAATGGCTTTGAAGG - Intergenic
1049415795 8:142494459-142494481 GTGTGTGTCACATGCTTGTAGGG + Intronic
1049601095 8:143508037-143508059 GTGTGTGCCACATGGGTTGAGGG - Intronic
1051527364 9:18061266-18061288 GTGTTTATGAAATGCTCTGATGG + Intergenic
1055277365 9:74634224-74634246 GTTTGTGTCAAGTGCTGTGGTGG - Intronic
1058771762 9:108240897-108240919 CTGTGGGTCAAAGGCCTTGATGG + Intergenic
1059264399 9:113012288-113012310 GTGTCTTTCTAATGCTTTGCGGG + Intergenic
1186002288 X:5026309-5026331 GTGAGTGTCAAGAGATTTGATGG + Intergenic
1188640319 X:32493249-32493271 TTGTGTTTCAAATGAATTGAGGG - Intronic
1189999360 X:46670647-46670669 TTGTGTCTCAAATGCTTAGAAGG + Intronic
1193468733 X:81875367-81875389 GTGTGTGTCAATTGGTTTATGGG + Intergenic
1194743657 X:97605330-97605352 GTGGGCTTCAAATGCTTAGAAGG + Intergenic
1197236342 X:124069272-124069294 GTGCTTTTCAAATGCTTTTATGG + Intronic
1197845776 X:130800842-130800864 GTGCTTGTCAAATGCTATGAGGG + Intronic
1199195463 X:145024447-145024469 GTGTGTGTCACCTCATTTGAAGG + Intergenic
1199376161 X:147112079-147112101 GTGTTTGTAATATTCTTTGATGG - Intergenic
1199415661 X:147579958-147579980 GTGTGTGTGAATTGCTTTTGAGG - Intergenic
1199462071 X:148095895-148095917 GTATGTGTTAAATGCATGGATGG - Intergenic
1199899587 X:152159910-152159932 GTGTCTGTCCGTTGCTTTGAAGG + Intergenic
1201589091 Y:15593822-15593844 GAGTGAGGGAAATGCTTTGAGGG - Intergenic
1202331159 Y:23754527-23754549 ATATGTGACAAATTCTTTGAAGG - Intergenic
1202348630 Y:23962671-23962693 ATGTGTGACAAATTTTTTGATGG - Intergenic
1202522144 Y:25707433-25707455 ATGTGTGACAAATTTTTTGATGG + Intergenic
1202539610 Y:25915533-25915555 ATATGTGACAAATTCTTTGAAGG + Intergenic