ID: 988484226

View in Genome Browser
Species Human (GRCh38)
Location 5:31655073-31655095
Sequence AGCACGGAAGACTCCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988484226_988484228 -4 Left 988484226 5:31655073-31655095 CCATCAGTGGAGTCTTCCGTGCT 0: 1
1: 0
2: 0
3: 7
4: 143
Right 988484228 5:31655092-31655114 TGCTACCCTACACTAGCCCATGG 0: 1
1: 0
2: 1
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988484226 Original CRISPR AGCACGGAAGACTCCACTGA TGG (reversed) Intronic
900747486 1:4371137-4371159 AGCAAGGAAGACTTCACTTAAGG + Intergenic
904113932 1:28148087-28148109 AGGAAGGAAGACTTCTCTGAAGG + Exonic
904610371 1:31722792-31722814 GGCAGAGGAGACTCCACTGAGGG - Intergenic
905514170 1:38549667-38549689 AGCATGGAATCCACCACTGAGGG - Intergenic
908966937 1:69776971-69776993 CACAGGGAAGACTCCATTGAGGG - Intronic
1065795346 10:29302430-29302452 ATCATGGAAGACTCCATTAAAGG - Intronic
1073686629 10:105761556-105761578 AGCAGGGAAGCTTCCACTGCAGG + Intergenic
1073870514 10:107858500-107858522 CGCAAGGAAAACTCTACTGAAGG + Intergenic
1074936634 10:118188324-118188346 ATCACAGAGGAATCCACTGATGG + Intergenic
1085083711 11:73652975-73652997 AGCATGGAAGACAGCACTGCTGG + Exonic
1087383134 11:97434022-97434044 AGAAAGGAAGACTCCAGAGATGG - Intergenic
1087759038 11:102086164-102086186 AGCATGGAAGCCTCCTCTGCAGG + Intergenic
1089402099 11:118170275-118170297 GGCAGGGAAGACTGCTCTGAGGG + Intronic
1089906316 11:122043480-122043502 ATCACGGAAATCTCCACAGATGG + Intergenic
1091036713 11:132240679-132240701 AAAATGGAAGACTGCACTGAAGG + Intronic
1092080812 12:5714499-5714521 AGCATGGAACACTCCAGTTATGG + Intronic
1093130614 12:15387526-15387548 ATCAAGGAGGACTTCACTGAGGG - Intronic
1098828774 12:75332907-75332929 ATCAGGGAAGACTTCACTGAAGG + Intronic
1100234366 12:92644109-92644131 AGCAAAAAAGACTCCACTGAAGG - Intergenic
1104781244 12:131421949-131421971 AGCAGGCCAGACTCCTCTGAGGG - Intergenic
1107932372 13:45316690-45316712 AGCCCGGAAGACTTGGCTGAGGG + Intergenic
1112437163 13:99398818-99398840 GGCAGGGAAGACTTCACTCAAGG - Intergenic
1114364020 14:22007592-22007614 AGCACGGAACATTTCACTCAGGG + Intergenic
1114508992 14:23241113-23241135 ATCACGGAAGACTTCACAGAAGG + Intronic
1115070125 14:29311982-29312004 AGCATGGAAGTTTCCTCTGATGG - Intergenic
1115504142 14:34078348-34078370 AGCACATAAGACTCCTCAGAAGG + Intronic
1118923755 14:70173050-70173072 AGTAGGGAAGACTTCACTCATGG + Intronic
1121430478 14:93882879-93882901 AGCACGGCAGACTCAAGAGATGG + Intergenic
1125552216 15:40553831-40553853 AGCAGGGAGAAATCCACTGAAGG - Intronic
1125716363 15:41822089-41822111 AGCCCGGAGCACCCCACTGAAGG + Exonic
1129599185 15:76988347-76988369 AGGACGGAGGACTGCAGTGATGG - Intergenic
1132050855 15:98606652-98606674 GGCCAGGTAGACTCCACTGAGGG - Intergenic
1132245449 15:100292933-100292955 ACCAAGGAAGACCCCACAGAGGG + Intronic
1144292078 17:13836427-13836449 AGCAAGGAACAGTCCAATGATGG + Intergenic
1148732086 17:49843456-49843478 AGCATGGAAGGCACCACTCAGGG + Intronic
1149015828 17:51907360-51907382 AGCCGGGAAGGCCCCACTGAAGG - Intronic
1150334928 17:64323823-64323845 AGAACGGAAGGCTCCCTTGATGG - Exonic
1151277699 17:73048195-73048217 AGCACTGAAGACTCTAAGGAGGG - Intronic
1151628728 17:75295240-75295262 AGCCCGGAAGACCACAGTGAGGG - Intergenic
1152791806 17:82284088-82284110 AGCACTGAAGCATCCACTCAAGG + Intergenic
1153371048 18:4316581-4316603 AGCACAGAAGACAACAATGATGG + Intronic
1155428669 18:25732810-25732832 AGCACTGTAGACTTCATTGAAGG + Intergenic
1156040930 18:32822044-32822066 AGCAGGGAACACTGCTCTGAGGG + Intergenic
1160623440 18:80187119-80187141 ATCAAGGAAGAATCCACTAAGGG + Intronic
1161498369 19:4599268-4599290 GGCATGGAAGACCCCACTGTGGG - Intergenic
1163521112 19:17792606-17792628 AAAACTCAAGACTCCACTGATGG + Intergenic
1165574112 19:36799546-36799568 AGCACGGAAGACTCAACGGCTGG + Intergenic
1165621812 19:37254494-37254516 AGCACGGAAGACTCAACAGCTGG + Intergenic
1165633397 19:37320633-37320655 AGCACAGAAGACTCAACAGCTGG + Intronic
1166167481 19:41002113-41002135 AGATCTGAAGTCTCCACTGAGGG - Intronic
1166443758 19:42840051-42840073 ATCAGGGAAGACACCTCTGAGGG - Intronic
1166463443 19:43010714-43010736 ATCACGGAAGACACCTGTGAGGG - Intronic
1167760221 19:51441984-51442006 ATCACGGAAGATTCCCCTAAAGG + Intergenic
1168155240 19:54470576-54470598 AGAAAGAAAGACTACACTGAGGG + Intronic
925093490 2:1174186-1174208 AGTATGGAAGACTGCACAGATGG - Intronic
928215000 2:29354081-29354103 AGCACATGAGACTACACTGAAGG - Intronic
932301294 2:70668843-70668865 AGCAGGGAAGACACCAGTGGAGG + Intronic
937284055 2:120738805-120738827 AGCCCGGAAGTCTCTGCTGAAGG - Intronic
943589793 2:189783940-189783962 AGCAGGGGGGACTCCCCTGAGGG - Intronic
948705205 2:239787219-239787241 AGCAGAGAAGAGTCCATTGAAGG + Intronic
1170083056 20:12497825-12497847 ATCACAGAAGAGGCCACTGAGGG - Intergenic
1170901876 20:20471682-20471704 AGCACGAGAGAGTACACTGAAGG + Intronic
1172170806 20:32930819-32930841 AGCACGGAATTCTCCAGGGAAGG - Intronic
1175958486 20:62623273-62623295 ACCACAGAAAACTTCACTGATGG - Intergenic
1179627088 21:42654662-42654684 CCCACGGAGTACTCCACTGAAGG + Intronic
1182932366 22:34187364-34187386 AGCCCAGAAGAGTCCCCTGAGGG - Intergenic
952254167 3:31681241-31681263 TGCAAGGAAGACCCCAGTGAAGG + Intronic
955647832 3:61159437-61159459 TGCACAGAAGACTCAACTGTAGG + Intronic
956937259 3:74117164-74117186 ATCAGGGAAGACTTCTCTGATGG - Intergenic
960181798 3:114588741-114588763 GGCACGGAACTCTCCACTGTAGG + Intronic
960869860 3:122238002-122238024 TGAACAGAAGCCTCCACTGATGG + Intronic
961472338 3:127123779-127123801 TGCACTGAAGACTCAACTGTGGG + Intergenic
965549257 3:169947611-169947633 AGCACGGAGGCCTCCAGTGCAGG - Intergenic
971825108 4:31611087-31611109 AGCACAAAAAACTCCTCTGAGGG - Intergenic
973250994 4:48059718-48059740 AGCAGGGAGGACTCCTGTGAGGG + Intergenic
975878431 4:78871499-78871521 TGCCCAGAAGACACCACTGAAGG + Intronic
976824764 4:89248769-89248791 AGCAGGAATGACTCCAGTGAGGG - Exonic
979765377 4:124459390-124459412 AGCACAGAAGACACCTCTGTGGG + Intergenic
985872173 5:2565520-2565542 AGGACGGAAGGGTCCTCTGAGGG - Intergenic
985901302 5:2796811-2796833 GGCACGTAATACTACACTGAAGG - Intergenic
988484226 5:31655073-31655095 AGCACGGAAGACTCCACTGATGG - Intronic
995551440 5:113285661-113285683 ATCAGGGAAGACTTCACTGTGGG - Intronic
1001779508 5:174355744-174355766 ACCACTGAAGATTCCACTCAAGG - Intergenic
1001965671 5:175908419-175908441 AGCAAGGAACACTCCTCAGAGGG - Intergenic
1002251277 5:177930776-177930798 AGCAAGGAACACTCCTCAGAGGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1008839241 6:55879676-55879698 AGCATGGAAGAATACACTAAAGG + Intergenic
1012203721 6:96436498-96436520 AGCACAGAAGCCTCCACAGGTGG + Intergenic
1018195625 6:161353932-161353954 AGCACAGAAGACTTCTGTGACGG - Intronic
1018244266 6:161806653-161806675 AGGACGGAACACTCCAATGCAGG + Intronic
1019184603 6:170213791-170213813 AGCACTGAAGACTCCACACTGGG + Intergenic
1019184641 6:170214000-170214022 AGCACGGAAGACTCCACACCAGG + Intergenic
1019184672 6:170214159-170214181 AGCACTGAAGACTCCAGACAGGG + Intergenic
1019184724 6:170214419-170214441 AGCACTGAAGACTCCACACCGGG + Intergenic
1019184809 6:170214839-170214861 AGCACTGAAGACTCCACACCGGG + Intergenic
1019184841 6:170214995-170215017 AGCACTGAAGACTCCACACCGGG + Intergenic
1019184879 6:170215204-170215226 AGCACTGAAGACTCCACACCGGG + Intergenic
1019184909 6:170215361-170215383 AGCACTGAAGACTCCACACGGGG + Intergenic
1019184919 6:170215414-170215436 AGCACTGAAGACTCCACACCGGG + Intergenic
1019184983 6:170215724-170215746 AGCACTGAAGACTCCACACCGGG + Intergenic
1019184994 6:170215777-170215799 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185053 6:170216036-170216058 AGCACCGAAGACTCCACACCGGG + Intergenic
1019185064 6:170216089-170216111 AGCACCGAAGACTCCACACCGGG + Intergenic
1019185076 6:170216142-170216164 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185111 6:170216297-170216319 AGCACCGAAGACTCCACACCGGG + Intergenic
1019185123 6:170216350-170216372 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185199 6:170216708-170216730 AGCACCGAAGACTCCACACCGGG + Intergenic
1019185211 6:170216761-170216783 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185234 6:170216865-170216887 AGCACTGAAGACTCCACACCAGG + Intergenic
1019185354 6:170217440-170217462 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185365 6:170217493-170217515 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185424 6:170217752-170217774 AGCACCGAAGACTCCACACCGGG + Intergenic
1019185435 6:170217805-170217827 AGCACCGAAGACTCCACACCGGG + Intergenic
1019185447 6:170217858-170217880 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185523 6:170218216-170218238 AGCACCGAAGACTCCACACCGGG + Intergenic
1019185535 6:170218269-170218291 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185559 6:170218373-170218395 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185680 6:170218948-170218970 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185712 6:170219104-170219126 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185770 6:170219417-170219439 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185789 6:170219522-170219544 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185810 6:170219627-170219649 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185850 6:170219837-170219859 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185869 6:170219942-170219964 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185880 6:170219995-170220017 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185891 6:170220048-170220070 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185902 6:170220101-170220123 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185921 6:170220206-170220228 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185931 6:170220259-170220281 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185942 6:170220312-170220334 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185952 6:170220365-170220387 AGCACTGAAGACTCCACACCGGG + Intergenic
1019185992 6:170220575-170220597 AGCACTGAAGACTCCACACCGGG + Intergenic
1019186033 6:170220782-170220804 AGCACTGAAGACTCCACACGGGG + Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1030678577 7:112409848-112409870 ATCAAGGAAGACTTTACTGAAGG - Intergenic
1033151390 7:138917818-138917840 AAAAGTGAAGACTCCACTGAAGG + Exonic
1038787941 8:30638304-30638326 AGCACTGAAGTATTCACTGAAGG + Intronic
1039905060 8:41780539-41780561 AGGAAGGAAGAATCTACTGAGGG - Intronic
1046000148 8:108410675-108410697 ATCATGGAAGATTCTACTGAAGG - Intronic
1051697368 9:19783387-19783409 CTCTAGGAAGACTCCACTGAAGG + Intronic
1057733848 9:97634305-97634327 GGCTCGGAAGAATTCACTGAAGG + Intronic
1057850493 9:98563352-98563374 ATCAGGCAAGACTGCACTGAAGG + Intronic
1058378843 9:104356787-104356809 AGCATGGAAGATCTCACTGAAGG + Intergenic
1058629571 9:106972658-106972680 AGCAGGGAAGACACTACTGCCGG - Intronic
1059029746 9:110678354-110678376 AGCCCAGAAGGATCCACTGAAGG - Intronic
1060862582 9:126967106-126967128 AACACGGAAGAAGCCAATGATGG - Intronic
1061287166 9:129630624-129630646 AACACGGAAGAGTCCACATATGG - Intronic
1185717482 X:2354338-2354360 AGCATGGAACACGCCACTGCTGG + Intronic
1192905301 X:75544681-75544703 AGCACAGAAGCCTCAGCTGAAGG - Intergenic
1193088258 X:77467152-77467174 AGAATAGAAGGCTCCACTGATGG + Intergenic
1200357532 X:155567769-155567791 AGAACTGAAAGCTCCACTGATGG + Intronic