ID: 988489098

View in Genome Browser
Species Human (GRCh38)
Location 5:31692045-31692067
Sequence GGGCGCAGTGGAGCACGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988489085_988489098 12 Left 988489085 5:31692010-31692032 CCGCATTCCTCAGCCCTTGGGTG 0: 14
1: 472
2: 330
3: 262
4: 402
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data
988489091_988489098 -2 Left 988489091 5:31692024-31692046 CCTTGGGTGGTCGATGGGACTGG 0: 641
1: 570
2: 324
3: 264
4: 288
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data
988489079_988489098 26 Left 988489079 5:31691996-31692018 CCTGTGCCCTGCACCCGCATTCC 0: 1
1: 1
2: 25
3: 191
4: 757
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data
988489087_988489098 5 Left 988489087 5:31692017-31692039 CCTCAGCCCTTGGGTGGTCGATG 0: 672
1: 634
2: 441
3: 258
4: 206
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data
988489084_988489098 13 Left 988489084 5:31692009-31692031 CCCGCATTCCTCAGCCCTTGGGT 0: 24
1: 522
2: 644
3: 394
4: 391
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data
988489080_988489098 20 Left 988489080 5:31692002-31692024 CCCTGCACCCGCATTCCTCAGCC 0: 2
1: 73
2: 392
3: 542
4: 576
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data
988489090_988489098 -1 Left 988489090 5:31692023-31692045 CCCTTGGGTGGTCGATGGGACTG 0: 659
1: 576
2: 339
3: 260
4: 275
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data
988489081_988489098 19 Left 988489081 5:31692003-31692025 CCTGCACCCGCATTCCTCAGCCC 0: 1
1: 10
2: 62
3: 130
4: 363
Right 988489098 5:31692045-31692067 GGGCGCAGTGGAGCACGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988489098 Original CRISPR GGGCGCAGTGGAGCACGGGG TGG Intronic
No off target data available for this crispr