ID: 988489160

View in Genome Browser
Species Human (GRCh38)
Location 5:31692293-31692315
Sequence TTGCGCTGGCCCGCAAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988489152_988489160 20 Left 988489152 5:31692250-31692272 CCGGGCGAGTGCGGGGTCCGCGG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG 0: 1
1: 0
2: 5
3: 14
4: 56
988489156_988489160 -5 Left 988489156 5:31692275-31692297 CCTACGCCCACTCGGAACTTGCG 0: 1
1: 14
2: 163
3: 281
4: 808
Right 988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG 0: 1
1: 0
2: 5
3: 14
4: 56
988489151_988489160 24 Left 988489151 5:31692246-31692268 CCGGCCGGGCGAGTGCGGGGTCC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG 0: 1
1: 0
2: 5
3: 14
4: 56
988489154_988489160 3 Left 988489154 5:31692267-31692289 CCGCGGAGCCTACGCCCACTCGG 0: 1
1: 0
2: 33
3: 187
4: 718
Right 988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG 0: 1
1: 0
2: 5
3: 14
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988489160 Original CRISPR TTGCGCTGGCCCGCAAGCAC CGG Intronic
901640833 1:10692300-10692322 GTGTGCTGGCCCACAAGCAGAGG + Intronic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924671277 1:246128637-246128659 TGGGGCTGGCCCTCAAGCCCAGG + Intronic
1077764561 11:5144445-5144467 TCGCGCTGGTCAGCAAGCGCTGG - Intergenic
1085924314 11:80997505-80997527 TTGCGCAGTCCTGCATGCACGGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1112264639 13:97912286-97912308 TTGTGCTGGCCCACATGCACAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1118690947 14:68339221-68339243 TTAAGCTGGCCCACAAGTACAGG - Intronic
1118888334 14:69885832-69885854 TTAAGCTGGCCCACAAGTACAGG - Intronic
1119411737 14:74436082-74436104 TTGCTCTGGCCAGCAAAGACGGG + Intergenic
1129161489 15:73750522-73750544 TTGAGCTGGGCCTCAAGCAGTGG + Intronic
1130026816 15:80277301-80277323 CTGCGCTGGGCCCCCAGCACAGG + Intergenic
1130086243 15:80780139-80780161 TAGCGCTGTCCCGGAGGCACTGG - Intronic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1134089704 16:11384952-11384974 TTGAGCTGGCCAGCGAGGACGGG - Exonic
1162584781 19:11552087-11552109 TTGAGCTGGCCCGGAAGCCCTGG - Intronic
1162954267 19:14089833-14089855 TTGCGCTGCCCCGCGGGGACAGG - Exonic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943065287 2:183079575-183079597 CTGCGCAGGCCAGCAAGCACAGG - Intronic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
944054871 2:195513097-195513119 TTGGCCTGGCTCCCAAGCACTGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1180804568 22:18653574-18653596 TTGCGCTGGAGAGCAACCACTGG + Intergenic
1203235045 22_KI270731v1_random:145007-145029 TTGCGCTGGAGAGCAACCACTGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953959379 3:47255890-47255912 TGGCGCGCGCCCGCAATCACAGG - Intronic
954659904 3:52221490-52221512 TTGTGCTGGCCCACACGGACCGG - Exonic
959323633 3:104908871-104908893 TTGAACTGGCCAGTAAGCACTGG - Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
972321726 4:37977946-37977968 TTGCGCTGGGCCGCCTGGACAGG + Intronic
973144285 4:46805121-46805143 TCGCGCTGGCCTCCAAGCACCGG + Intronic
973764339 4:54149628-54149650 TCGCGCTGGCCGGCGAGCACGGG + Intronic
973878090 4:55241533-55241555 TTGCGCTGGGCAGCAAGTGCGGG - Intergenic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
975754795 4:77561919-77561941 TTGTGCTGGCCCACAAGCACTGG - Intronic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984728631 4:183045108-183045130 TCGCACTGGTCCGCAAGCACGGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG + Intronic
992717881 5:79529582-79529604 TTAAGCTGGCCCACAAGTACAGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997183466 5:131857756-131857778 CTTTGCTGGCCCGCAAGCGCAGG + Intronic
997282087 5:132655859-132655881 TTGCTCTGGCCCCGAAGCGCTGG - Intergenic
997476025 5:134143030-134143052 ATGAGCTGGCCCGCAAGGAGAGG + Exonic
1000609117 5:163355889-163355911 TCGCACTGGCCCACAAGCACCGG - Intergenic
1004906184 6:20239095-20239117 TCGCGCTGGCCCACAAGTACCGG - Intergenic
1005487983 6:26319533-26319555 TTGCACTGCCCCGCAAGACCTGG + Intergenic
1012131264 6:95496975-95496997 TTGCGCTGGTCCATGAGCACTGG - Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1021510965 7:21432013-21432035 TAGCGCTGGCCTAGAAGCACTGG - Intronic
1027137669 7:75636805-75636827 TGACCCTGGCCCGTAAGCACTGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035678041 8:1468625-1468647 ATGCACTGGCCCCAAAGCACAGG - Intergenic
1036123850 8:6045346-6045368 TCGCACGGGCCCGCAAGCACCGG + Intergenic
1043224041 8:77700757-77700779 CTGCGCAGGCCCGCAAGCACTGG - Intergenic
1048536145 8:135296776-135296798 TTGCCCTGGCGCGCATGCAACGG - Intergenic
1049336560 8:142089736-142089758 TGGGGCAGGCCCACAAGCACAGG + Intergenic
1055849147 9:80604596-80604618 TTGAGCTGGCCAGCAAGAAATGG - Intergenic
1057880579 9:98790153-98790175 TTGCACTGGACTGCAAGCACAGG - Exonic
1059330422 9:113532052-113532074 TGGCCCTGGCCCAGAAGCACTGG - Intronic
1186031063 X:5369465-5369487 TTGCGCTGTCGCCCAAGCTCTGG + Intergenic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1200002360 X:153068636-153068658 TTCAGCTGGCCCCAAAGCACAGG - Intergenic
1200005364 X:153081374-153081396 TTCAGCTGGCCCCAAAGCACAGG + Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic