ID: 988489821

View in Genome Browser
Species Human (GRCh38)
Location 5:31696902-31696924
Sequence GGTTCTGCTTGTTCATCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
988489820_988489821 -5 Left 988489820 5:31696884-31696906 CCTCTCAAAGGCTTTAGTGGTTC 0: 1
1: 0
2: 1
3: 4
4: 77
Right 988489821 5:31696902-31696924 GGTTCTGCTTGTTCATCTGAAGG No data
988489817_988489821 28 Left 988489817 5:31696851-31696873 CCTATGTTGGAGAGACAGTCATC 0: 1
1: 0
2: 2
3: 9
4: 125
Right 988489821 5:31696902-31696924 GGTTCTGCTTGTTCATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988489821 Original CRISPR GGTTCTGCTTGTTCATCTGA AGG Intronic
No off target data available for this crispr