ID: 988490361

View in Genome Browser
Species Human (GRCh38)
Location 5:31700541-31700563
Sequence TGCAGGGAATGCGGCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
988490361 Original CRISPR TGCAGGGAATGCGGCAACCC TGG (reversed) Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901341021 1:8499472-8499494 TCCAGGGAATGCTGCCACACAGG + Intronic
902589042 1:17460420-17460442 TGCAGAGAAGGAGGCAACTCCGG - Intergenic
903477019 1:23626549-23626571 TGCAGGGAAGAGGGTAACCCAGG - Intronic
904295953 1:29519869-29519891 TGCTGGGAAAACAGCAACCCCGG + Intergenic
907222057 1:52914382-52914404 TGCAGGGAAGGGGGCAGTCCAGG + Intronic
912515185 1:110212422-110212444 TGGAGGGGATGCGGCAAAGCAGG - Intronic
916773674 1:167937142-167937164 GGCACGGAATTCGGCAACCAAGG - Intronic
917535965 1:175874867-175874889 TGCAGGGAATGCTGCTCCACTGG - Intergenic
918073641 1:181152603-181152625 TATGGGGAATGCGGGAACCCGGG + Intergenic
918182991 1:182101278-182101300 TTCAGGGAATGGGGGAAACCTGG + Intergenic
922744528 1:228036811-228036833 TGCAGTGGATGCAGCAGCCCAGG + Intronic
1064259733 10:13775657-13775679 TGATGGGGATGCGGCATCCCGGG + Intronic
1067763637 10:49069363-49069385 GGCAAGGACTGTGGCAACCCTGG + Intronic
1067798433 10:49338175-49338197 GGCAGGGACTCCAGCAACCCAGG + Intergenic
1071799469 10:89042788-89042810 TGAAAGGAATGAGGCAATCCTGG - Intergenic
1072158389 10:92744296-92744318 TGAAGGGAAAGCAGCAGCCCAGG - Intergenic
1076612855 10:131737327-131737349 TGTAGGGAATGGGTGAACCCAGG + Intergenic
1076812892 10:132898475-132898497 CCCAGGGGATGGGGCAACCCAGG - Intronic
1076849562 10:133086362-133086384 TGCAGGGAAAGAGACAAGCCAGG + Intronic
1080957666 11:37119318-37119340 TTCAGGCGATGCAGCAACCCTGG + Intergenic
1081744261 11:45462033-45462055 TGCTGTGAATGCAGCAGCCCTGG + Intergenic
1084673770 11:70622569-70622591 TCCAGGGGCTGCGGCCACCCTGG + Intronic
1084787615 11:71452754-71452776 TGCTGGGAATCCCGCCACCCTGG - Intronic
1088191156 11:107229526-107229548 TGCAGGGAATGCCCCAAACCTGG - Intergenic
1089062576 11:115637923-115637945 TGCATTAAATGCGGCAACTCTGG - Intergenic
1089457613 11:118634610-118634632 TGCAGGGGATGAGGTAACACAGG - Intronic
1090385474 11:126355666-126355688 TGCAGGGGAGGCGGGGACCCGGG - Intronic
1090796971 11:130143451-130143473 GGCAGGGAGCGCGGCAGCCCTGG + Exonic
1095419135 12:42007067-42007089 TGCAGTGAATGAAGCATCCCTGG - Intergenic
1095981528 12:47977238-47977260 TCCAGAGACTGCGGAAACCCAGG + Intronic
1103094058 12:118118786-118118808 TGTAGGGAATGCTATAACCCAGG - Intronic
1106242164 13:27920881-27920903 AGCAGGGGATCCGGGAACCCAGG + Intronic
1109547734 13:63849048-63849070 AGCAGGGAACCTGGCAACCCAGG - Intergenic
1122821191 14:104345999-104346021 TGGAGGGAAGGAGGCAGCCCTGG - Intergenic
1123393288 15:19899411-19899433 TGCAGGGGCTGCGGCCAGCCGGG + Intergenic
1125743257 15:41982199-41982221 TGCAGGAAACCCAGCAACCCTGG - Exonic
1126180537 15:45780974-45780996 TGCAGGGAGTGTGGCACCCGAGG - Intergenic
1127355099 15:58190727-58190749 GGCATGGAATGCTGCATCCCAGG - Intronic
1127630878 15:60826472-60826494 TTCAGGGACTGAGGCAGCCCAGG + Intronic
1132884220 16:2175476-2175498 TGCAGGGATTGCTGCAACTGTGG - Intronic
1132995866 16:2822140-2822162 TGCAGGAAATGGGGAAACCGAGG + Intronic
1133248372 16:4464092-4464114 TTCTAGGAATGCAGCAACCCAGG - Intronic
1134840974 16:17401283-17401305 TGCTGGGAATGGAGCCACCCGGG + Intronic
1136776992 16:32877305-32877327 AGCAGGGAAGGCAGCAGCCCAGG - Intergenic
1136893624 16:33984208-33984230 AGCAGGGAAGGCAGCAGCCCAGG + Intergenic
1137290508 16:47049178-47049200 TGCAGGGATTGCGGCAGCCAGGG + Intergenic
1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG + Intergenic
1141742964 16:85906486-85906508 TTCAGGGCAGGCGGCAAGCCAGG + Intronic
1141926846 16:87175364-87175386 TGCAGGGACCTGGGCAACCCAGG + Intronic
1203079409 16_KI270728v1_random:1139414-1139436 AGCAGGGAAGGCAGCAGCCCAGG - Intergenic
1142849568 17:2697835-2697857 TGCAGGGAGTGCGGGCGCCCTGG - Intronic
1143129016 17:4664395-4664417 CACAGGGACTGTGGCAACCCAGG - Intergenic
1143497664 17:7321663-7321685 GGCAGGGAAGGAGGCAGCCCTGG + Exonic
1147918155 17:43900742-43900764 TGCAGAGCAGGCGGTAACCCGGG + Intronic
1148588948 17:48801162-48801184 GGCAGGGAAAGTGGCAACCAGGG + Intronic
1155367147 18:25059828-25059850 AGCAGGTAATGTGTCAACCCAGG - Intergenic
1157975674 18:52324217-52324239 AGCAGTGAGTTCGGCAACCCAGG - Intergenic
1161326784 19:3667965-3667987 GGCAGGGAGGGCGGCAGCCCTGG - Intronic
1161784149 19:6312606-6312628 TTCAGGCAATGCATCAACCCAGG + Intronic
1162757839 19:12870952-12870974 TGCAGGGAAGGAGGCACCCTGGG + Intronic
1164064531 19:21704464-21704486 TCCTGGGGATGCGGCAACCATGG + Intergenic
1166990435 19:46689681-46689703 TGCAGAGCCTGCGGCATCCCGGG - Exonic
1167304049 19:48696705-48696727 TGCCGGGAATCCGGGAATCCCGG + Intronic
925261068 2:2529085-2529107 TTCAGGCAATGTGGCAAGCCAGG - Intergenic
926018337 2:9474086-9474108 CGCAGGCACTGCGGAAACCCTGG - Intronic
926233761 2:11024064-11024086 TTCAGGGACTGCAGCATCCCAGG - Intergenic
928169078 2:28991887-28991909 CCCAGGGAATGGGGCGACCCGGG - Intronic
928296751 2:30090370-30090392 AGCAGTGAATGTGGCAAACCAGG - Intergenic
935616089 2:105083355-105083377 TGCAGGAAAGGAGGTAACCCTGG - Intronic
937237822 2:120441481-120441503 TGCTGGGACTGCGGGAGCCCCGG + Intergenic
938375178 2:130800164-130800186 TGCACTGAATGCTGCAGCCCTGG + Intergenic
938880617 2:135582582-135582604 TGCAGGGAATGGGGGAAGTCTGG + Intronic
941321099 2:164055710-164055732 TGCAGCAAATGCAGAAACCCTGG + Intergenic
943185037 2:184597591-184597613 TCCAGGGAATGCTGCAGACCCGG + Intergenic
945948080 2:216013424-216013446 TGCGGGGACAGCGGCAGCCCGGG + Exonic
945971867 2:216238619-216238641 TGCATGGAATCAGGCAAACCGGG + Intergenic
948167330 2:235873098-235873120 TGCAGAGACTGCGGGACCCCAGG + Intronic
948825725 2:240572727-240572749 TGCAGGGAACGGGGGAAGCCGGG + Intronic
1173820091 20:46014007-46014029 TGCAGGGACTGCGGGCACGCGGG + Intronic
1178832820 21:36070514-36070536 TGCAGGGAGTGCAGAAACCTTGG + Intronic
1179557529 21:42189956-42189978 TGCTGGGAATTTGCCAACCCTGG - Intergenic
1180156431 21:45979616-45979638 TGCAGGGAATGCTGCATTCTTGG + Intergenic
1180858357 22:19062374-19062396 TCCAGGGAAGCCGGCCACCCAGG + Intronic
1184664047 22:45978227-45978249 AGCAGGGACTGCGGCCACCAAGG + Intergenic
1185056225 22:48579776-48579798 AGGAAGGAATGCGGCAAGCCTGG + Intronic
949571966 3:5302093-5302115 TGCTGGGAATGCCCCATCCCCGG + Intergenic
953025801 3:39144215-39144237 TGCAGGCACTGCGCCAATCCCGG - Exonic
955807761 3:62755177-62755199 TGCAGGGAAGGAAGGAACCCGGG - Intronic
959930656 3:111978699-111978721 TGCAGGTGATGCAGCAAGCCTGG + Intergenic
962518831 3:136179277-136179299 TGCAGGGATTGCTTGAACCCAGG - Intronic
963107627 3:141660290-141660312 TGGAGGGACTGTGGCCACCCAGG - Intergenic
964972203 3:162576721-162576743 GGAGGGGAATGTGGCAACCCCGG + Intergenic
970360188 4:15301609-15301631 TGCAGGGTGTGAGGTAACCCAGG + Intergenic
972568243 4:40287774-40287796 GGCAGGGAATGCTTGAACCCGGG - Intergenic
984766492 4:183404300-183404322 CTCAGGGAATGCTGGAACCCTGG - Intergenic
985451855 4:190067148-190067170 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985452845 4:190070440-190070462 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985453832 4:190073733-190073755 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985454820 4:190077026-190077048 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985455808 4:190080323-190080345 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985456791 4:190083617-190083639 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985457779 4:190086913-190086935 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985458767 4:190090210-190090232 TGCAGGGAAGGGTGCAAGCCCGG + Intergenic
985543964 5:500087-500109 CGCACTGACTGCGGCAACCCCGG + Intronic
986456363 5:7924546-7924568 TGCAGGAAATGGGACAACACCGG + Intergenic
988490361 5:31700541-31700563 TGCAGGGAATGCGGCAACCCTGG - Intronic
992950371 5:81852021-81852043 TGCAGGGAGCGCGGCAGCCGCGG - Intergenic
998992527 5:147833661-147833683 TGCAGGAAATGCAGAAACCCAGG - Intergenic
999782844 5:154864363-154864385 GGCAGAGAATGCGTGAACCCGGG + Intronic
1001954453 5:175838727-175838749 CGCAGGGAATGAGGGGACCCAGG + Intronic
1005178377 6:23074355-23074377 TTCAGGGCATGTGACAACCCAGG - Intergenic
1007655268 6:43447747-43447769 TCCAGGGCATTCGGCAGCCCTGG - Exonic
1009452464 6:63817783-63817805 TGCAGGGCAGGCGGCAAGCAAGG - Intronic
1015376457 6:132515578-132515600 TTCAGGGAATGCTGCAATCATGG - Intergenic
1015840113 6:137467846-137467868 TGCTGGGAATGCAGCATCCTGGG - Intergenic
1015882120 6:137880139-137880161 GGGAGGGAATGCGGCACCCTTGG + Exonic
1018397734 6:163392206-163392228 GGGAGGGAATGCGGAAGCCCAGG + Intergenic
1019642166 7:2109351-2109373 CGCAGGGAACACGGCAACACAGG + Intronic
1021190939 7:17619068-17619090 TACAGGGAATGCATTAACCCTGG - Intergenic
1027305942 7:76897559-76897581 TGGAGGTGATGCAGCAACCCAGG + Intergenic
1028549610 7:92045422-92045444 TGTAGGCACTGTGGCAACCCTGG - Intronic
1031960924 7:127989172-127989194 TGCCAGGAATGAGGCAGCCCTGG + Intronic
1034669653 7:152848352-152848374 GGCAGGGAATGCTGCAGCCTTGG - Intronic
1035142841 7:156781416-156781438 TGCAGGAAATGTGGAAACCTGGG - Intronic
1036198542 8:6745681-6745703 AACAGGGAATACGACAACCCAGG - Intronic
1037774080 8:21821273-21821295 TGGAGGGAAAGAGGCCACCCAGG + Intergenic
1040072084 8:43196568-43196590 TGCAGGGAATGCAGAAGCCCAGG - Intronic
1040484021 8:47853420-47853442 GGCAGGGCAGGCGGAAACCCAGG + Intronic
1041076468 8:54174558-54174580 TGCAAGAAATGCGGCAGCCCAGG - Intergenic
1047611303 8:126523460-126523482 GGCAGGGAATGCAGGAGCCCAGG + Intergenic
1048221596 8:132547030-132547052 TGCAGGGGATAGTGCAACCCAGG + Intergenic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1057893218 9:98885141-98885163 TCCAGGGAATGTGGCCTCCCTGG - Intergenic
1062307848 9:135919744-135919766 TGCAGGGGCTGCTGGAACCCAGG + Intergenic
1203781098 EBV:101257-101279 TGCAGGGAATGCGGCCCCGGCGG + Intergenic
1186460727 X:9746449-9746471 TGCAGGGAATCCCCCATCCCAGG - Intronic
1200102869 X:153696738-153696760 GGCAGGGAAGGCAGCAGCCCAGG + Intergenic
1200267875 X:154655518-154655540 GGCAGGGAAGGCAGCAGCCCAGG + Intergenic